ID: 1001609130

View in Genome Browser
Species Human (GRCh38)
Location 5:172985738-172985760
Sequence AGGGCTAAGTGGAAACAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 319}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001609130_1001609135 -3 Left 1001609130 5:172985738-172985760 CCATCCTGTTTCCACTTAGCCCT 0: 1
1: 0
2: 4
3: 25
4: 319
Right 1001609135 5:172985758-172985780 CCTAGAGAGTGTCATGATTCAGG 0: 1
1: 0
2: 0
3: 3
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001609130 Original CRISPR AGGGCTAAGTGGAAACAGGA TGG (reversed) Intronic
900770123 1:4534302-4534324 AGAGTTAAGTGAAAACAGCAAGG + Intergenic
902745140 1:18468931-18468953 AGGGCTTTGTGGAAACAGGGAGG - Intergenic
903582723 1:24384230-24384252 AGGGCATAGTGGAAAGAGCAAGG - Intronic
903679790 1:25089223-25089245 AGGGCTGAGTGGGAGCAGGATGG + Intergenic
905282287 1:36856832-36856854 GGGGCAAAGTGTAAACAGGGTGG + Intronic
906165795 1:43685128-43685150 GGGGCTAGGTGGACAGAGGAGGG + Intronic
906167582 1:43698455-43698477 AGGGCTAAGTAGAAACTGCCTGG + Intronic
907503355 1:54899964-54899986 AGGGCTAAGCTAAAACAGTAAGG + Intergenic
909403189 1:75257728-75257750 AGGTCTAAGAAGAAACAGCAAGG + Intronic
909853030 1:80493494-80493516 AAGGCTGAGTGGAAAAGGGAAGG + Intergenic
911183973 1:94885482-94885504 ATGGCTTAGTGGAAAGAGGCTGG - Intronic
911705436 1:101006409-101006431 AGTAATAAGTGGAAACAGAAAGG + Intronic
911759559 1:101600142-101600164 AGGGCTAGGCTGAAACAGTAAGG + Intergenic
912148173 1:106820373-106820395 AGTGCTAAGAGGAACCAGGGTGG - Intergenic
912313117 1:108642831-108642853 TGGGCCAAGTCGAAACAAGAAGG - Intronic
912379926 1:109241849-109241871 AGGACTCAGGGGAAGCAGGATGG - Intergenic
912499470 1:110112512-110112534 CGGGCTGAGTGGAATCAGGAGGG - Exonic
912690226 1:111799544-111799566 TGGGCCAAGTGACAACAGGAGGG - Intronic
912709992 1:111943285-111943307 GGAGCTGAGTGGAAACAGGTGGG - Intronic
912759676 1:112356141-112356163 AGGGTTAATCGGAGACAGGAAGG + Intergenic
913264697 1:117033119-117033141 AGGGCTGAGTGAGAACGGGATGG + Intronic
913384788 1:118247778-118247800 AGAGCAAAGTGGATACAGCAGGG - Intergenic
913524813 1:119680517-119680539 AGAGCCAGGTGGAAACAAGAGGG + Intronic
914027718 1:143927118-143927140 GGAGCTACGTGGAAACAGAATGG + Intergenic
914239152 1:145840040-145840062 AGGGCGAAGTGGGCACATGAGGG - Intronic
914960105 1:152197504-152197526 AGGGGGAAGGGGAAAAAGGAAGG - Intergenic
916379206 1:164189577-164189599 GGGGCTGAGCTGAAACAGGAGGG + Intergenic
919565930 1:199187909-199187931 AGGGCTTAGTGGAATAAGAATGG + Intergenic
919589313 1:199480619-199480641 AGGGCAAAGGGGACACGGGATGG - Intergenic
919934347 1:202241674-202241696 AGGGCAAGGGGGAAACAGCATGG + Intronic
920255614 1:204652225-204652247 AGGGCGAAGGGGAGAGAGGAGGG - Intronic
921264967 1:213414778-213414800 ATGGGTAACTGGAAGCAGGAGGG + Intergenic
921520352 1:216149157-216149179 AGGGCTAGGTTAAAACAGTAAGG - Intronic
922550030 1:226488087-226488109 AGGGCTGAGTCAACACAGGAAGG - Intergenic
923760018 1:236833595-236833617 AGGGGGCAGTAGAAACAGGAAGG + Intronic
924276746 1:242396394-242396416 AGGGCAAAGTGGGGTCAGGAGGG - Intronic
924932857 1:248746518-248746540 AGGGCTGAGAGGACACAGGAAGG + Intronic
1063853884 10:10224692-10224714 AGTGCTCAGAAGAAACAGGAAGG - Intergenic
1064797060 10:19024419-19024441 AGGCCTAAATGGTAAGAGGAGGG + Intergenic
1066282940 10:33935865-33935887 TAGGCTAAGTGCAAACAGTAGGG - Intergenic
1067029189 10:42868924-42868946 AGGGCTGGGTGGGCACAGGATGG - Intergenic
1067048809 10:43000471-43000493 AGGGGCAAGTGGAAGAAGGACGG + Intergenic
1067064885 10:43098239-43098261 AGGGCTTGGGGGAGACAGGATGG - Intronic
1070041926 10:72789686-72789708 AGGGATTAATGGAAACAGAAAGG - Intronic
1071463215 10:85918014-85918036 AGGGAGAAGTGGAGACAGGGTGG + Intronic
1071680675 10:87702599-87702621 AGGGCCAAGTTAAAACAGGGCGG + Intronic
1072624272 10:97101031-97101053 AGGGCTCAGTGCCAGCAGGAAGG - Intronic
1072802579 10:98403381-98403403 AGGACTCGGAGGAAACAGGAGGG - Intronic
1073565045 10:104527878-104527900 AGGGCAGAGAGGAAAGAGGATGG - Intergenic
1073616722 10:105003950-105003972 AGGGATAAGAGGAAACAAGGAGG - Intronic
1073803691 10:107071899-107071921 AGGGGAAAATGGAAACAGGTTGG + Intronic
1074412841 10:113243042-113243064 ATGGATACGTGGAAGCAGGAGGG + Intergenic
1074974211 10:118567195-118567217 ATGGCTAAGAGGAAACATTAGGG + Intergenic
1076381076 10:130024874-130024896 AGTGCAAATTGGAGACAGGATGG + Intergenic
1076475300 10:130747599-130747621 AAGGCTAGGAAGAAACAGGAAGG - Intergenic
1077109380 11:855376-855398 AGGGCTGCGTGGGAACAGCAAGG - Intronic
1077165821 11:1137659-1137681 AGGGCCAACTGTACACAGGACGG - Intergenic
1078425523 11:11247521-11247543 AGAGCTAAGAGGAGAAAGGATGG - Intergenic
1081486412 11:43533361-43533383 AGGGCTAAGGGAAACCAGCAAGG + Intergenic
1081808715 11:45903545-45903567 AGGGCTGAGTGGATAAATGAAGG - Intronic
1084922144 11:72479822-72479844 GGGCCTTACTGGAAACAGGATGG + Intergenic
1085688829 11:78649490-78649512 AGGGCTGAGTGAAGAGAGGAAGG - Intergenic
1087070067 11:94070213-94070235 AAGGATAAATGGCAACAGGAGGG - Intronic
1087234683 11:95704963-95704985 AGGGCTAAATGGAAACATTAGGG - Intergenic
1087365802 11:97217400-97217422 AGGGGAAAGTGGAAGCAGGATGG - Intergenic
1087528868 11:99353610-99353632 ATGGCTAAGTCAAAAGAGGAGGG + Intronic
1087850825 11:103027519-103027541 ATGGCACAGAGGAAACAGGAAGG + Intergenic
1088318125 11:108527904-108527926 TGGCATAAGTGGAAACATGATGG + Intronic
1089279527 11:117363552-117363574 AGGGCTTAATAAAAACAGGAGGG - Intronic
1089450999 11:118596782-118596804 GGGGCAAAATGGAAACATGATGG - Intronic
1091076268 11:132620511-132620533 AAGGCTAAGGGGAATCAGGAAGG + Intronic
1092944734 12:13442176-13442198 AGGGAGAAGTGGAAAGAGAAGGG - Intergenic
1093001109 12:13997119-13997141 ATGGCTAAGTGGAAATAGGAAGG + Intergenic
1093245685 12:16733347-16733369 GGGGCTAAATGGAATCATGAAGG + Intergenic
1093751791 12:22808083-22808105 ATGGGGAACTGGAAACAGGATGG + Intergenic
1096748957 12:53746770-53746792 AGGGCTCAGCGGCCACAGGAGGG - Intergenic
1097288293 12:57894187-57894209 AAGGCTAATTTGAAACAGAATGG + Intergenic
1098490381 12:71069109-71069131 GGGGATAAATGGAAACAGGTGGG - Intronic
1099895803 12:88645109-88645131 GTGGGTAAGTAGAAACAGGAAGG - Intergenic
1100196623 12:92253613-92253635 AGGGCTAAGTGAAAGAAGGGAGG + Intergenic
1100867980 12:98877913-98877935 AGGCCTCAGTGGAAACACGAAGG + Intronic
1101020608 12:100549380-100549402 AGGGCAAAGGGGAAAAAGAATGG + Intronic
1101436283 12:104667533-104667555 GGAGCCAAGTGGACACAGGATGG + Intronic
1102283348 12:111635596-111635618 AGGGCGCAGTGGAAACAGGATGG - Intergenic
1102932774 12:116875426-116875448 AGGGCACTGTGGATACAGGAAGG - Intronic
1103512315 12:121483894-121483916 AGGGCTAAGGGAAAACAGCCAGG + Intronic
1104133183 12:125914248-125914270 AGGGCTTAGAGGAGACAGAATGG - Intergenic
1105255215 13:18739741-18739763 AGGGCCAAGGGGAACCAGGGGGG - Intergenic
1106013873 13:25850064-25850086 AGGGCTGAGATGAGACAGGAGGG - Intronic
1106138810 13:26993771-26993793 TGGTCTAAGTGGAAAAAAGAAGG - Intergenic
1106712514 13:32353257-32353279 AGAGATAAGTGAAAAGAGGAGGG - Intronic
1108178695 13:47820217-47820239 AGGGCTAAGTAGAAAATGAAGGG - Intergenic
1108506897 13:51120436-51120458 AGGGCAATGTGGATACAGCAGGG - Intergenic
1108606040 13:52039675-52039697 AGGTCTAAGTAAAAACATGATGG - Intronic
1109636462 13:65124452-65124474 AAGGGGAAGAGGAAACAGGAGGG - Intergenic
1110033980 13:70655104-70655126 AGGGCAAAGGGGAAGCAGGCAGG - Intergenic
1112149903 13:96747098-96747120 AGGGCTAAGTGAAATCAATATGG + Intronic
1113453084 13:110426292-110426314 AGTGTAAAGTGGAAACATGAAGG - Intronic
1114587083 14:23825146-23825168 AGGTGTAAGAGGAAGCAGGAGGG + Intergenic
1114722365 14:24896205-24896227 ATGGCTAAGTGCCAACAGGCTGG - Intronic
1115385037 14:32787880-32787902 TGTAATAAGTGGAAACAGGAGGG - Intronic
1115680000 14:35727776-35727798 AAGGATATGTAGAAACAGGAAGG + Intronic
1116727798 14:48584199-48584221 AGTGGGAAGTAGAAACAGGATGG + Intergenic
1116968064 14:51035329-51035351 AGATCTAAGTGGAAACTTGAGGG + Intronic
1118012847 14:61627746-61627768 AGGCCTAAGAGGCAAGAGGATGG - Intronic
1119062676 14:71492131-71492153 AGGGCTGAGTGCAAAGAGGGTGG + Intronic
1119320807 14:73729181-73729203 AGGACTATGAGCAAACAGGATGG + Intronic
1122309612 14:100786207-100786229 TGGGATGAGAGGAAACAGGAAGG + Intergenic
1122330083 14:100905917-100905939 AATGCTCAGAGGAAACAGGATGG - Intergenic
1122884633 14:104705602-104705624 AGGGCTGCATGGATACAGGAGGG - Intronic
1123928503 15:25143284-25143306 AGGACTCAGTGGAAATAAGATGG + Intergenic
1124637440 15:31374036-31374058 AGGGCTGAGTAGAAGCAGGATGG - Exonic
1124657608 15:31521889-31521911 AGGGCTAAGTGGAAGCTGAGAGG - Intronic
1127587617 15:60393808-60393830 AGACCTATGAGGAAACAGGAGGG - Intronic
1127665484 15:61141959-61141981 TGGGCTAAGTGGAAAAGGGGAGG + Intronic
1127735456 15:61835028-61835050 AGAGCTAGGAGGAAACAGAATGG + Intergenic
1128584899 15:68839884-68839906 GAGCCTAAGTGGAATCAGGAGGG + Intronic
1129119523 15:73387514-73387536 AGGGGGAAGAGCAAACAGGAGGG + Intergenic
1129324293 15:74791933-74791955 CAGGCTAATTGGAAACAGGAAGG - Intronic
1129451478 15:75653559-75653581 AGGGCACAGTGGAAACAGCCTGG - Intronic
1129659726 15:77546448-77546470 AAGGGGAAATGGAAACAGGAAGG - Intergenic
1130738531 15:86574227-86574249 TGGACTAACAGGAAACAGGAAGG - Intronic
1131278593 15:91002961-91002983 AGGCCTGAATGGAAACAGGAGGG + Intronic
1131598605 15:93824705-93824727 AGGGCTAATTGGACCCTGGAAGG + Intergenic
1131652728 15:94419414-94419436 AGGTATAAGTGGAAATATGAAGG + Intronic
1131904490 15:97127803-97127825 AGGGCTCAGTGGAAACTTTAGGG - Intergenic
1132339110 15:101066873-101066895 AAGGCAAAGTGGAAACAAGATGG + Intronic
1134413211 16:14020726-14020748 AGGGCTCATTGGCAACAGGAAGG - Intergenic
1134686391 16:16161725-16161747 TGGGCTTAGTTGAGACAGGACGG - Intronic
1134824376 16:17272741-17272763 AGGGCTAAGGGGACACTGGCCGG - Intronic
1134833195 16:17340112-17340134 AGGGATGAGTGGATACAGGATGG - Intronic
1134904051 16:17964120-17964142 AGTGCTGAGTGGCAAGAGGAAGG - Intergenic
1135025196 16:18994319-18994341 AGGGCTATGCGAAAACAGTAAGG + Intronic
1135501370 16:22998886-22998908 AGTGATAAGTGGAAAGAGAAAGG + Intergenic
1135706057 16:24676008-24676030 AGGGCTAAATGGAAAAGGAAGGG + Intergenic
1136227055 16:28866363-28866385 AGGGCTCAGGGGAGCCAGGATGG - Exonic
1136645146 16:31607920-31607942 ATGGCTAACTAGAAACAGCAGGG + Intergenic
1138641853 16:58393895-58393917 AGGGGGAAGTGGGAAAAGGAAGG - Intronic
1139794377 16:69470256-69470278 AGGGCGAAGTGGATTCAGTATGG + Intergenic
1140062537 16:71583293-71583315 AGGGCTAAGGGGAAATTGAAGGG - Intergenic
1140382630 16:74504235-74504257 AGGGCCAAGGAGAGACAGGAGGG + Intronic
1140625564 16:76789897-76789919 AGGGCTAAGCAGAAACTAGAAGG - Intergenic
1140718105 16:77745128-77745150 AGGGCTAAGTGGGGACTAGATGG + Intergenic
1140856436 16:78981856-78981878 CTGGCAAAGTGGACACAGGAAGG - Intronic
1141796758 16:86280152-86280174 AGGGCTAGGTTAAAACAGTAAGG - Intergenic
1141886768 16:86897587-86897609 AAGGCGATGTGGGAACAGGAGGG + Intergenic
1142503676 17:349121-349143 AGGGCTCAGAGGGAAAAGGAGGG + Intronic
1142806265 17:2372679-2372701 AGGGCGATGTGGAGGCAGGACGG - Intronic
1143859705 17:9879794-9879816 AGGGTTAAGGGGCAACATGAGGG + Intronic
1143919583 17:10320426-10320448 AGGGCGAAGAGGAAGCTGGAAGG - Exonic
1143929024 17:10401121-10401143 AGAGCAAAGCGGAAACTGGAGGG - Exonic
1143939883 17:10529411-10529433 AGGGCTAAGAGGAAACTTGAGGG - Exonic
1144022703 17:11251254-11251276 AGGGCTCTGTGGAACCAGAACGG + Intronic
1144883867 17:18445377-18445399 AGGGAAAAATGAAAACAGGAAGG - Intergenic
1145148365 17:20499000-20499022 AGGGAAAAATGAAAACAGGAAGG + Intergenic
1146647997 17:34588055-34588077 AAGGCTCAGAGGAAACTGGAGGG - Intronic
1147133457 17:38421936-38421958 AGGGCAAAATGGAGACAGGGAGG + Intergenic
1147301872 17:39535869-39535891 AGGGCTAAGTGGAATGGGAATGG + Intronic
1148641382 17:49190310-49190332 AGGGAGAAGTGGAAGTAGGAAGG + Intergenic
1149663303 17:58347919-58347941 AGGGCCTAGTGCAAAGAGGAGGG + Intronic
1150610801 17:66731599-66731621 AGGGCTCAGCAGAAAAAGGAAGG - Intronic
1151911260 17:77084861-77084883 AGGGCTGAGAGGAAGCAGGTGGG - Intergenic
1152206965 17:78979407-78979429 AGGCCTATGTGCAAACAGGGAGG + Intronic
1154435806 18:14340861-14340883 AGGGCCAAGGGGAACCAGGGGGG + Intergenic
1155144067 18:23069082-23069104 AGGGGAAAGAGGAAGCAGGAGGG + Intergenic
1156840725 18:41607021-41607043 GGGGGAAAGTAGAAACAGGACGG - Intergenic
1157029276 18:43885638-43885660 AGGGCTATGTGTGGACAGGAAGG + Intergenic
1157250858 18:46094896-46094918 AGGGCTAAATGGTAACAATATGG + Intronic
1157879528 18:51306978-51307000 AGGGATAAGAGAAGACAGGAAGG + Intergenic
1158160092 18:54471608-54471630 TGGGCTAAGTGGGATCAAGAAGG + Intergenic
1158411258 18:57208111-57208133 AGGGCAAAGAGGATAAAGGAGGG + Intergenic
1158666539 18:59437993-59438015 TGGGCTGAGTGGCATCAGGAAGG + Intronic
1158808983 18:61009101-61009123 GGGGCTAAATGGAAATAGAAAGG - Intergenic
1160714783 19:571297-571319 AGGGCTAACTGGAAAGGGGCAGG - Intronic
1161661946 19:5552083-5552105 AGGGCTAGGTTAAAACAGTAAGG - Intergenic
1162194372 19:8972951-8972973 AGGGGGAAGTGGAAGAAGGATGG + Exonic
1163179898 19:15591955-15591977 AGGGCCAAGGGGAACCATGAGGG + Intergenic
1163429827 19:17260687-17260709 AGGGCTCAGAGGAGACAGCAGGG - Intronic
1163646083 19:18489873-18489895 AGGGGTCAGCAGAAACAGGAGGG - Intronic
1164870668 19:31640459-31640481 AGGGCGAAGTGGGAGCTGGAGGG + Intergenic
1165554263 19:36616760-36616782 AGGGCTAACTGGAAACAAAGTGG - Intronic
1165934790 19:39382777-39382799 AGGTCCAAGTGGGGACAGGAAGG + Intronic
1167802543 19:51754102-51754124 AGGGCTCATGGGAAACAGGTAGG - Intronic
1168286842 19:55339500-55339522 AGGTCCAAGTGGAAAGAGGGCGG - Intergenic
1168599459 19:57706382-57706404 AGTGTTAAGTGGACAGAGGAAGG - Intronic
925288184 2:2729476-2729498 AGGGCAGAGAGGAGACAGGAGGG + Intergenic
925508180 2:4593422-4593444 AGAGCTGAGGGGAAACAAGACGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927193972 2:20535169-20535191 AGGGCACACTGGACACAGGATGG - Intergenic
927340436 2:21977868-21977890 AGGGCCCAATGGAAATAGGATGG + Intergenic
927878647 2:26675323-26675345 CTGGTTCAGTGGAAACAGGATGG - Intergenic
928413160 2:31070012-31070034 GGGGGTAAGCGGACACAGGAAGG - Intronic
929183770 2:39071258-39071280 AGGGTTTAGTGGAAAGAGGCAGG - Intronic
930001686 2:46865943-46865965 CGGGCTACTTGGAAACAGGTGGG - Intergenic
931141461 2:59462993-59463015 AGAGCTAAGAGCACACAGGAAGG - Intergenic
934864189 2:97791388-97791410 AGGGCAAGGAGGAAGCAGGACGG - Intronic
935945313 2:108280802-108280824 AGGGTTAACTGGCAGCAGGAAGG - Intergenic
941183394 2:162288741-162288763 AGGGCTAAGTGAAACAAGCAGGG - Intronic
941841597 2:170091003-170091025 ACTGCTCAGTGGAAAAAGGATGG + Intergenic
942318408 2:174714973-174714995 AGGGCTGAGAGGAGGCAGGAGGG + Intergenic
943315596 2:186383959-186383981 AGTGCTAAGTGGGACCAGAAGGG - Intergenic
944818983 2:203409892-203409914 AGTGCTTAGTGGAAAGAGGTTGG - Intronic
945850873 2:215005232-215005254 AGGGCTAAGGGAAAAAATGAAGG + Intronic
1169042967 20:2510895-2510917 AGAGGTAAGTTGGAACAGGAAGG + Intronic
1170038366 20:12014125-12014147 AGAGCTGGCTGGAAACAGGAGGG - Intergenic
1170053604 20:12174501-12174523 AGTTCTAAGAGGAAGCAGGAGGG - Intergenic
1170110312 20:12797872-12797894 AGAGCAAAGAGGATACAGGAGGG - Intergenic
1170786440 20:19471622-19471644 AGGGCCAAGTAGAAACATGCAGG - Intronic
1170909966 20:20556780-20556802 AGGGATAAGTCTAAACAGAAAGG + Intronic
1171144565 20:22770456-22770478 AGTGCTCAGGGGACACAGGAGGG - Intergenic
1171933973 20:31256283-31256305 AGGCCTGAGTGGAAACTGCAAGG - Intergenic
1172094204 20:32452756-32452778 AGGGCAGAGGGGGAACAGGAGGG - Intronic
1172745269 20:37202884-37202906 AGGGCTAAGGGGAGACACAATGG + Intronic
1175333479 20:58179957-58179979 AGGGCTAGGGGGAAGCAGGACGG + Intergenic
1178242122 21:30914910-30914932 TGGGCTAATTGGAAAAAAGAGGG + Intergenic
1178270598 21:31186172-31186194 AGGGCTAAAATGAAACAGGCAGG + Intronic
1178942591 21:36918943-36918965 ATGTCTAATTGGAAACTGGAAGG + Intronic
1179998967 21:44986607-44986629 AGGGTCCAGTGGAAACAGGCGGG - Intergenic
1181615621 22:24052220-24052242 AGGGCTAAGTAGAAGCAGGAGGG + Intronic
1183371599 22:37435622-37435644 GGGGCTGAGTGGGACCAGGAGGG + Intergenic
1184220765 22:43098298-43098320 AGGGCAATGGGGCAACAGGAAGG + Intergenic
1184753437 22:46502387-46502409 AGGGTAAAGTGGAAAGAAGAGGG + Intronic
1184753455 22:46502438-46502460 AGGGTAAAGTGGAAAGAAGAGGG + Intronic
1185221128 22:49629736-49629758 AGGGCTGGGTTGGAACAGGAAGG + Intronic
949277340 3:2300502-2300524 GGGGCTAAATGGAAAGAGCAAGG - Intronic
950031772 3:9858514-9858536 TTGGCTAAGTGGAAAGATGAAGG - Intergenic
950142695 3:10626280-10626302 ATGGCAAAGTGGAAAAAGGCCGG - Intronic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
951310441 3:21119026-21119048 AGGTCTGAGTGGAAACACCAAGG - Intergenic
951526303 3:23656275-23656297 AGCGCTGGGTGGAAACAGGTAGG + Intergenic
951840333 3:27027280-27027302 AGAGTTATGTGCAAACAGGAAGG - Intergenic
951962335 3:28342036-28342058 AGGGATTAGTTGACACAGGAGGG - Intronic
952252169 3:31665647-31665669 AGGGTACAGTGGAAAGAGGAGGG - Intronic
954447330 3:50553761-50553783 AGGCCTAGGTGGAGACGGGAAGG - Intergenic
955057429 3:55469056-55469078 AGGGCTCAGTGTGAAGAGGAAGG + Exonic
955064903 3:55525802-55525824 AGGGCAAAGTGGAAGCTGGGTGG + Intronic
955139170 3:56252049-56252071 AGGGCTGGGTGAAAGCAGGAGGG + Intronic
960555321 3:119022267-119022289 GGGGTTAAGTGGAAACGGGGAGG + Intronic
962523709 3:136219826-136219848 AGGGCTAAGCTAAAACAGTAAGG + Intergenic
965110785 3:164419057-164419079 AGGGATAAGTAGCAACAGAAAGG - Intergenic
965881292 3:173391617-173391639 AGGGCTAGATAAAAACAGGATGG + Intergenic
966816943 3:183897067-183897089 AGGCCAAAGTGGAGCCAGGATGG + Intergenic
968121190 3:196127335-196127357 CTGGCTAAGAGTAAACAGGATGG + Intergenic
970853838 4:20632392-20632414 AGGGCTAGGCTGAAACAGTAAGG + Intergenic
970885735 4:20985782-20985804 AGGGTTTAGTGGTATCAGGAAGG + Intronic
971240290 4:24882254-24882276 GGAGCCAAGTGGAAACAGTAAGG + Intronic
972568502 4:40289780-40289802 GGGGGTAAGGGAAAACAGGAAGG + Intergenic
972689464 4:41382483-41382505 AGGGGGAATTGGAAGCAGGAGGG + Intronic
973300144 4:48572883-48572905 AGGGCTGAGTAGAGACAGTATGG + Intronic
975630539 4:76397275-76397297 AGGGATAGGTGGAAACAGAGTGG + Intronic
975971571 4:80044709-80044731 ATTTCTAAGTGGCAACAGGAAGG + Intronic
976441729 4:85083534-85083556 AGGGCTGAGTGGGAACCAGAAGG + Intergenic
976568760 4:86584354-86584376 AGGTCTAAGTGGAAAAACAAAGG + Intronic
977182699 4:93897311-93897333 AGGGCTAAATGGAGAGAGAAGGG - Intergenic
977262955 4:94819976-94819998 AGGGCTAAGAAGAAAAAGCAGGG - Intronic
977801711 4:101242424-101242446 AGTCCTAAGGAGAAACAGGAAGG + Intronic
978841959 4:113225145-113225167 AGGTCTAAATGAAATCAGGATGG - Intronic
978932337 4:114330282-114330304 TGGGCAAAGTGAAAACAAGAAGG - Intergenic
980654803 4:135767512-135767534 AGGGGTAAGGGGAAAGAGGAGGG + Intergenic
980664989 4:135921567-135921589 AGGTCTAAATAGAAACAGGCAGG + Intergenic
980929618 4:139173129-139173151 AGGGTTAACTGCAAACAGGCTGG + Intronic
981185064 4:141791692-141791714 AGTTCTAAGTGAAAAGAGGATGG + Intergenic
983152427 4:164301253-164301275 ATGGCTAAGTAGAAACTGAAAGG + Intronic
987487704 5:18541922-18541944 AGGGCTAGGCTGAAACAGTAAGG - Intergenic
987936604 5:24474733-24474755 AGGGAAAAGAGTAAACAGGAGGG + Intergenic
989084727 5:37663826-37663848 AGGGCTCAAAGGAAGCAGGAAGG - Intronic
989394860 5:40943172-40943194 AAGCCTAAGCTGAAACAGGAAGG + Intronic
990058651 5:51618833-51618855 AGGGCTGAGAAGAAACAAGACGG + Intergenic
991125016 5:63060411-63060433 AGGGCTAAGTAGAAAGAAGGGGG - Intergenic
991266834 5:64729636-64729658 AGGGCTAAGGGGAAAAGGCAGGG + Intronic
993482292 5:88438775-88438797 ATGGCTATGTGGCAACATGAAGG - Intergenic
994600389 5:101895096-101895118 AGGACTTAGTGGAAACATTAAGG - Intergenic
997412730 5:133702530-133702552 AGGGGTGAGTGGGAACAGGCAGG + Intergenic
998623802 5:143823264-143823286 GGGCCTGAGTGGAAACAGAATGG - Intergenic
999531913 5:152473016-152473038 AGGGCTAAGGGGGAAAATGAAGG - Intergenic
999551669 5:152694379-152694401 AAGGCTAAGTGAAAACAGCTTGG - Intergenic
999616749 5:153433091-153433113 AGGGCAAAGGGGTATCAGGAGGG - Intergenic
999982651 5:156972653-156972675 AGGGCAAAGGGGAGACAGAAAGG + Intergenic
1001065629 5:168532990-168533012 AGGGCCAAGGGAATACAGGAAGG + Intergenic
1001609130 5:172985738-172985760 AGGGCTAAGTGGAAACAGGATGG - Intronic
1003879040 6:10463813-10463835 AGGGGTAAGTGGAGTCAGGAAGG + Intergenic
1004004131 6:11623332-11623354 GGCCCTAAGTGGAAGCAGGAAGG - Intergenic
1004477295 6:15985596-15985618 ACCGCTAAGTGGAAAAAGGTGGG + Intergenic
1004890567 6:20096843-20096865 AGGGCCATGTGGACACAGAAAGG + Intergenic
1005014442 6:21363607-21363629 AGGGCTAGGCTGAAACAGTAAGG + Intergenic
1005255374 6:23997257-23997279 AGGGGGAAGGGGAAGCAGGAGGG - Intergenic
1005386686 6:25292480-25292502 AGAGATTAGTGGAAACAGGTAGG - Intronic
1006473279 6:34239997-34240019 AGGGGTAAGGGGAAAGAGGAGGG + Intronic
1006819976 6:36885518-36885540 TGGGCTGAGTGAAAACTGGAGGG + Intronic
1008271895 6:49499916-49499938 AGCCCTTAGTGGAAACAGGAGGG - Intergenic
1008800492 6:55362978-55363000 AGGAAGAAGAGGAAACAGGAAGG + Intronic
1009392995 6:63164947-63164969 AGGGCTAAATGGATTAAGGACGG + Intergenic
1010187132 6:73157339-73157361 AGGAGGAAGGGGAAACAGGAAGG + Intronic
1013237386 6:108209259-108209281 AGGGCTGAGTGGAAAAACCATGG + Intergenic
1013282082 6:108647996-108648018 AGAGCTAAGTGGAAAGAGGAGGG + Intronic
1013530425 6:111014521-111014543 TGGGCTAATGGGAAGCAGGAAGG + Intronic
1014000423 6:116359708-116359730 ATGGTTAAGTGGAAACAGATAGG + Intronic
1015882285 6:137881312-137881334 ATGGCTAACCGGAAACAGGTGGG + Exonic
1017072574 6:150588913-150588935 GGGGCTAAGTGGAAACAATGTGG - Intergenic
1017489743 6:154934642-154934664 ATGGCAAAGTGGGCACAGGACGG - Intronic
1018542889 6:164902128-164902150 ATGGCAAAGTGGAAAGAGGGTGG + Intergenic
1018588077 6:165385169-165385191 AGGACTTGGTGGTAACAGGATGG + Intronic
1020348029 7:7185876-7185898 AGGCTATAGTGGAAACAGGATGG + Intronic
1023196622 7:37647368-37647390 AGAGATAAATGGAAACAGTATGG + Intergenic
1023536607 7:41219542-41219564 AAAGCTAAGTTGCAACAGGAAGG - Intergenic
1024102889 7:46050889-46050911 AGGGAGAAGGGCAAACAGGAAGG + Intergenic
1024504434 7:50149870-50149892 AGGGAGAAGTGGAAACGAGAAGG - Intronic
1026677755 7:72442213-72442235 TGGGCAAGGTGGGAACAGGAAGG - Intronic
1027557038 7:79677751-79677773 AAGAATAAGTGGAAAAAGGAGGG + Intergenic
1028931901 7:96422412-96422434 AGGGGTAAGTGGTAAGAGGGAGG + Intergenic
1030160190 7:106499812-106499834 AGGGCTGAGAGGATACATGATGG - Intergenic
1033496972 7:141908940-141908962 AGGGCTAAATGGAGTCAGGGAGG + Intronic
1034448382 7:151124883-151124905 AGGGGTGAGTGGAAACAATACGG - Intronic
1037980532 8:23250172-23250194 AGAGCAAAGAGGACACAGGATGG - Intronic
1038415863 8:27395512-27395534 AGGGCCCAGGGGACACAGGAGGG - Intronic
1041176380 8:55201561-55201583 AGGTCAAAGTGGAGACAGGAGGG - Intronic
1041379537 8:57239402-57239424 AGGCCTAAGTGGAACCGAGAGGG + Intergenic
1043752548 8:83957508-83957530 AGGGTTCAATGGAAATAGGAAGG - Intergenic
1045922928 8:107553811-107553833 AGGGCTAAGTGGGAAGTGGGGGG - Intergenic
1046095958 8:109560777-109560799 ACGGCTATGTGGAGAAAGGATGG + Intronic
1046476367 8:114749892-114749914 AGGGAAAAGTGTAAGCAGGAGGG - Intergenic
1046485905 8:114888313-114888335 AGGAAGAAATGGAAACAGGAAGG - Intergenic
1047016127 8:120725145-120725167 GGAGGTAAGTGGAAAGAGGATGG + Intronic
1047748853 8:127865198-127865220 AGGGGTCACTGGAATCAGGATGG + Intergenic
1048097809 8:131313805-131313827 AGGGCTAAGCTAAAACAGTAAGG - Intergenic
1048102857 8:131373730-131373752 GGGGATAAGTAGAAACAAGATGG - Intergenic
1048421885 8:134284922-134284944 TGGGCTCAGTGGACACTGGAGGG + Intergenic
1052395638 9:27934809-27934831 ATGGCAGAGTGGAAAGAGGATGG + Intergenic
1053096957 9:35336944-35336966 AGGGCCATCTGGAAACAGAAAGG + Intronic
1055462706 9:76533908-76533930 AGGGCTCAGTGAAAACATTACGG - Intergenic
1056097131 9:83266809-83266831 AGTGCAAAGGGGAAACAGGAGGG - Intronic
1058775582 9:108280094-108280116 AGGGCAAGGTGGAAACCAGAGGG + Intergenic
1059672535 9:116505347-116505369 AGGGAGAGGTGGAAACAGGGAGG - Intronic
1060677752 9:125531102-125531124 AAGACTCAGTGGAAACAGCATGG - Intronic
1061268309 9:129521354-129521376 TGGGCCAAGTGGACACGGGAAGG + Intergenic
1062181312 9:135192658-135192680 ATGGCTTGGTGGAAACAGGAAGG - Intergenic
1062291883 9:135799091-135799113 GTGGCTAAGTGGCAACATGATGG - Intergenic
1185941410 X:4324089-4324111 AGGGCTGAATGCAAATAGGATGG - Intergenic
1186613989 X:11167292-11167314 AGTGCTAAGGGGAAAAAGCAGGG + Intronic
1187151778 X:16687699-16687721 TGGGGCAAGTGGAATCAGGAAGG - Intronic
1187933971 X:24318246-24318268 AGGGCTAACTGGAACCAGCGAGG + Intergenic
1189988168 X:46572019-46572041 AGGGAAAAGTGAAAACAGAAGGG + Intergenic
1192995911 X:76513143-76513165 AGGTCTAGGAGCAAACAGGAGGG - Intergenic
1194538303 X:95136183-95136205 TGGGCTAGGTGGCAACAGGGTGG + Intergenic
1195453038 X:105037147-105037169 AGGGCTGAGTGGAAACTTGGTGG + Intronic
1196137626 X:112227259-112227281 AGGGCTATGAGTAAATAGGAAGG + Intergenic
1197332815 X:125175172-125175194 AGAGATAAGTGGAAAGAGCAAGG + Intergenic
1199985733 X:152948814-152948836 AGGGCAAAGAGGAGCCAGGAAGG + Intronic
1202017426 Y:20425256-20425278 AGGGCTGAGAGGAAAGAGGAGGG + Intergenic