ID: 1001610344

View in Genome Browser
Species Human (GRCh38)
Location 5:172995908-172995930
Sequence CTCTAGAAAGAAATCCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001610344 Original CRISPR CTCTAGAAAGAAATCCTGGC TGG (reversed) Intronic
902045836 1:13523755-13523777 CTCAAGAAAGAAATTCAGGCCGG - Intergenic
903194621 1:21675985-21676007 CTGTAGGCAGAAATACTGGCTGG - Intergenic
904622314 1:31782831-31782853 CACTTTAAAGAAATCCAGGCAGG - Intergenic
905531198 1:38680179-38680201 CTCCAGAAAGAAATGCAGCCTGG + Intergenic
906535300 1:46547994-46548016 CTCTTGAAAGCCATCCTGACTGG - Intronic
906928896 1:50149100-50149122 CTCTAGAAAGAAATTAGGCCAGG + Intronic
909378179 1:74964724-74964746 CTCTATAAATAGCTCCTGGCAGG - Intergenic
910159403 1:84257492-84257514 CTCTGGGAATTAATCCTGGCTGG - Intergenic
910674505 1:89803041-89803063 GTCTAAAAAGAATTCCAGGCCGG + Intronic
911858160 1:102908876-102908898 GTCTAGTTAGAAATACTGGCAGG + Intronic
911888788 1:103340563-103340585 ATCTAGAAAGAGATGCTGGGTGG + Intergenic
912365760 1:109132444-109132466 CTCTATAAATAATGCCTGGCAGG - Intronic
912401261 1:109395776-109395798 CTCAAGGAATAAATCCAGGCAGG + Intronic
913066769 1:115263174-115263196 CATGAGAAAGAAATCCTGACAGG - Intergenic
915106395 1:153537308-153537330 CTCTAGAAAGAAGTCGTTGTAGG + Exonic
915397735 1:155598409-155598431 TTTTTTAAAGAAATCCTGGCCGG - Intergenic
915459628 1:156062074-156062096 CTCAAGAGAGAAGTCCTGGCCGG - Intronic
915931582 1:160063635-160063657 CTCCACAAAAAAATTCTGGCGGG + Intronic
916266978 1:162899879-162899901 CTTTAAAAATAACTCCTGGCAGG + Intergenic
916282193 1:163064038-163064060 TTCTAGAAAGAAAGCTTGGGAGG - Intergenic
918704945 1:187648120-187648142 TTCCAGAAAGTATTCCTGGCAGG - Intergenic
919681374 1:200438588-200438610 GTATAGAAAGAAATCCGGGCTGG + Intergenic
921415736 1:214884680-214884702 CCCCAGAAAGAGACCCTGGCAGG + Intergenic
921983859 1:221287035-221287057 TTCCAGAAAGAAAGTCTGGCTGG - Intergenic
922521081 1:226252964-226252986 CTCAAAAAAGAAATCCCAGCTGG + Intronic
923518245 1:234715634-234715656 CTCTGGAAAGAGGTCCTTGCTGG + Intergenic
924926019 1:248681723-248681745 CTCTACAAAGAAAACCTCACAGG + Exonic
1062792133 10:314479-314501 TTCTTTAAGGAAATCCTGGCTGG - Intronic
1068180043 10:53505250-53505272 TTTAGGAAAGAAATCCTGGCTGG - Intergenic
1068228190 10:54134455-54134477 CTTTTGAAAGAAATTCAGGCTGG + Intronic
1068320716 10:55410703-55410725 CTCCAGAAAGCAAAGCTGGCAGG - Intronic
1069114662 10:64489956-64489978 CTATATAAAGAACTCCTGGTTGG + Intergenic
1069259513 10:66376280-66376302 CTCTATTAAGAATTCCTGACAGG + Intronic
1069469424 10:68674258-68674280 ATTTAGAAAGAAAACCTAGCTGG - Intronic
1070434167 10:76372314-76372336 CTCTTTGAAGAAATCCTTGCCGG + Intronic
1072171006 10:92861605-92861627 CTCTTGACTGAAACCCTGGCAGG + Intronic
1072290719 10:93961910-93961932 CTCAGAAAAGAAATCCTGGCCGG - Intergenic
1072708308 10:97698208-97698230 AGCTAGCAAGAAATCATGGCTGG - Intergenic
1073006953 10:100331520-100331542 CCCTATAAAGAGATCTTGGCTGG + Intergenic
1074091978 10:110269080-110269102 CTTTAAAAATAATTCCTGGCTGG + Intronic
1074100368 10:110349854-110349876 CACTGGAAAGAAATTCTGGGTGG + Intergenic
1074876706 10:117619188-117619210 CTCCAGAAATAAAGCCAGGCGGG + Intergenic
1075203096 10:120422626-120422648 CTCTGTAAAGAAAGCGTGGCTGG + Intergenic
1076246268 10:128949973-128949995 CTTCAGAAAGAAATTCAGGCTGG - Intergenic
1076524109 10:131100316-131100338 ACCTAGAGAGAAAGCCTGGCTGG + Intronic
1077194646 11:1273197-1273219 CTAAAAAAAGAAATCCTGACTGG + Intergenic
1080007734 11:27427603-27427625 CTTTACAAAGAAATTCTGGTGGG + Intronic
1083067972 11:59945443-59945465 CTATAAAGAGAAATGCTGGCTGG + Intergenic
1083391630 11:62355518-62355540 TTCAAGAGAGAAATCTTGGCCGG - Intronic
1083574202 11:63777645-63777667 CTCTATAAAGAAAAACTGGATGG + Intergenic
1084583780 11:70041796-70041818 CTCTTGAAAGAAAACATTGCAGG - Intergenic
1085196616 11:74676483-74676505 GCCTAGAAAGACCTCCTGGCAGG - Intergenic
1086224221 11:84488298-84488320 CACTGGAAAGGAATCCTGGGAGG + Intronic
1087750964 11:102006402-102006424 CTCTGAAAAGAAACCTTGGCTGG - Intergenic
1088511151 11:110576454-110576476 ATTTAGAGAGAAATCCTGTCTGG + Intergenic
1088896831 11:114084715-114084737 CTCAAGTTAGAAATCCTGGGAGG + Intronic
1090128380 11:124114219-124114241 CTCTGGAGAGAAATCATGTCTGG - Intergenic
1090499727 11:127249670-127249692 CTTTAGACAGTAATCCTGGCTGG - Intergenic
1091854773 12:3730778-3730800 CTGCAAAAAGAAATCCTGGAAGG + Intronic
1092972398 12:13709710-13709732 CTCTAAAACGAAGTCCCGGCAGG + Intronic
1093086829 12:14875139-14875161 CTGTAGAAAGAAATAGTGGGAGG + Intronic
1093385248 12:18545190-18545212 CTGCAGAAAGAAACCCAGGCTGG - Intronic
1094335526 12:29346484-29346506 TACTATAAAGAAATGCTGGCTGG - Intronic
1097177088 12:57149531-57149553 CTCTATTGAGAAATCCTTGCCGG - Intronic
1099310234 12:81011226-81011248 CAATAGAAACAAATTCTGGCTGG + Intronic
1101039590 12:100741166-100741188 CTATAGAAGGAAAACATGGCAGG - Intronic
1101691907 12:107090767-107090789 CTCAAGACAGAGATCCAGGCAGG - Intronic
1101746799 12:107547960-107547982 CTCTAGAAAGAATCACAGGCAGG - Intronic
1104504928 12:129322607-129322629 TTCTAGAAAAAAATCCTTCCTGG - Intronic
1104728232 12:131090794-131090816 CTTTAGAATAAATTCCTGGCAGG + Intronic
1106536633 13:30650278-30650300 ATTAAGAAAGAAATGCTGGCCGG + Intronic
1107543419 13:41414664-41414686 TTCTGAAAACAAATCCTGGCTGG + Intergenic
1107548683 13:41456563-41456585 TTCTGAAAACAAATCCTGGCTGG + Intergenic
1110399530 13:75073576-75073598 CTTCATAAAGAAGTCCTGGCTGG + Intergenic
1112271552 13:97974905-97974927 CTTTAGAAAAAAATCTTGGCTGG + Intronic
1113660233 13:112102610-112102632 CAGGAGAAAGAAAACCTGGCAGG + Intergenic
1115011577 14:28554188-28554210 CTCTAGAAAGACATCCTAGTTGG + Intergenic
1117117197 14:52526446-52526468 CTGTAGAAGGAAATCCTGTGTGG + Intronic
1117560450 14:56932663-56932685 TTTTATAAAGAAATCCTGGAAGG + Intergenic
1118673385 14:68155486-68155508 CTCTATAAAGAAATATAGGCCGG - Intronic
1119687830 14:76646780-76646802 TTCAACATAGAAATCCTGGCTGG + Intergenic
1120741975 14:88118408-88118430 CCCCAGGAAGAAATCCTTGCAGG - Intergenic
1122673743 14:103392743-103392765 CTCTACAAAGTATTGCTGGCTGG - Intronic
1124357876 15:29010552-29010574 CTATATAAAGAACTCCCGGCCGG - Intronic
1126200901 15:45984727-45984749 CTCCAGAAAGAAATGCAGTCTGG + Intergenic
1126636093 15:50781182-50781204 CTCTAGAGAGCAAACCTTGCTGG + Intergenic
1126851019 15:52796931-52796953 GTCTAGAATCCAATCCTGGCTGG + Intergenic
1127732770 15:61815771-61815793 CTCAAGAAAGAAGACGTGGCAGG - Intergenic
1127946497 15:63760052-63760074 TCCTGGAAAGGAATCCTGGCTGG - Intronic
1129317955 15:74757430-74757452 ATATATAAAGAACTCCTGGCCGG + Intergenic
1129757509 15:78107429-78107451 CTCTGGAAAGATTTGCTGGCTGG + Intronic
1130002175 15:80057291-80057313 CCCTATAAAGAAACCTTGGCAGG - Intergenic
1130049902 15:80475256-80475278 CTCTAGAAAACATTCTTGGCTGG + Intronic
1130222690 15:82033849-82033871 CTCTAAAAAGTAAAGCTGGCCGG - Intergenic
1130794914 15:87197608-87197630 CTCCTGAAAGAGATCCTGGTGGG + Intergenic
1132366063 15:101257861-101257883 CTTTAAAAAAAAATCATGGCCGG - Intergenic
1135202609 16:20451650-20451672 CTCTAGAAAGACATCCTGAGAGG + Exonic
1135216494 16:20576216-20576238 CTCCAGAAAGACATCCTGAGAGG - Exonic
1137352931 16:47729938-47729960 CTCTAGAAGTATGTCCTGGCTGG - Intergenic
1137384919 16:48032587-48032609 CTCCAGAAATAAAACCTAGCAGG + Intergenic
1137428984 16:48403037-48403059 CTCTTGAAAGAAATGAGGGCTGG - Intronic
1138948081 16:61876169-61876191 CTAAAGAAAGAAAACCTGGCCGG - Intronic
1139587148 16:67911365-67911387 CTCTTGAAGGAAATGCTGGCTGG - Intronic
1139587760 16:67915311-67915333 CTCCAGAGGCAAATCCTGGCAGG + Intronic
1140682296 16:77397103-77397125 TCCTAGAAAGCAATCCAGGCCGG - Intronic
1140724888 16:77802967-77802989 CTCACGAAAGAAATCATTGCTGG - Intronic
1140837208 16:78806221-78806243 CTCATGAAAGAAATCCTGAGAGG - Intronic
1142220592 16:88852952-88852974 CTCAAAAAAAAAGTCCTGGCTGG + Intronic
1144598484 17:16591590-16591612 ATTTAAAAAGATATCCTGGCCGG - Intergenic
1146134415 17:30305916-30305938 ACCTAGAAAGAAGTCCTGGTTGG + Intergenic
1146178855 17:30684587-30684609 GTCTATAAAGAGAGCCTGGCTGG + Intergenic
1146729035 17:35178194-35178216 CTGTAGAAAGAAGTGCTGGCTGG - Intronic
1149579503 17:57739364-57739386 CGTAAGAAAGAAAACCTGGCAGG - Intergenic
1150467353 17:65404520-65404542 ATGTAAAAAGAAACCCTGGCTGG - Intergenic
1150731462 17:67698701-67698723 GGCTAGAAAGTAATTCTGGCTGG - Intergenic
1151626119 17:75276977-75276999 CTCTTAAAACATATCCTGGCCGG - Intronic
1153359768 18:4180903-4180925 GTCTAGAAAGAAGGCCAGGCTGG + Intronic
1153775422 18:8449138-8449160 ATAAAGAAAAAAATCCTGGCAGG - Intergenic
1153777106 18:8463827-8463849 CACTAGAGAAACATCCTGGCTGG - Intergenic
1153989245 18:10381059-10381081 CTTTAGAAAGAACTCTTGACTGG + Intergenic
1155280591 18:24235709-24235731 CTCTAGCAAGAGATCAAGGCTGG + Intronic
1155468671 18:26167975-26167997 CTCTGGAAAGAACAACTGGCAGG - Intronic
1155888544 18:31238141-31238163 CTCTGGAAAGAGAGCCTGCCTGG - Intergenic
1157879205 18:51304181-51304203 CACTAGGAAGAAATCATGGAGGG + Intergenic
1158084041 18:53628773-53628795 CTCAAGAGAGAGATCCTGTCTGG - Intergenic
1161559997 19:4967970-4967992 CTCCAGGAAGAACTGCTGGCTGG + Intergenic
1163531348 19:17850891-17850913 CTCTAAAAGGAAGTTCTGGCCGG + Intergenic
1165521128 19:36314820-36314842 GTCTAGAAGGCAATCCTGGAGGG + Intergenic
1166684093 19:44784860-44784882 ATCTAGAAACAAAAGCTGGCTGG - Intronic
1167809396 19:51815263-51815285 CTCTATAAAAAAATGTTGGCTGG + Intronic
925514558 2:4666167-4666189 CTCTATAAAGAAACCCTGTATGG - Intergenic
926344890 2:11936075-11936097 CTCTAGAAATTGATCCTGGAGGG + Intergenic
926680205 2:15657395-15657417 GATTAAAAAGAAATCCTGGCTGG + Intergenic
926845121 2:17128153-17128175 CTCCAGAAAGGAATGCAGGCAGG + Intergenic
927054997 2:19359094-19359116 CTCTGGAAAGAGATTCTGGGAGG - Intergenic
928533849 2:32219730-32219752 ATATATAAAGAAGTCCTGGCCGG - Intronic
928915227 2:36463461-36463483 CTAAAAAAAGACATCCTGGCAGG - Intronic
929602887 2:43215664-43215686 CCCTGGAATGAAATCCTGGAGGG + Intergenic
933149204 2:78893888-78893910 TTTAAAAAAGAAATCCTGGCTGG + Intergenic
934900232 2:98154155-98154177 CAGTAGAAAGAAATCCTGCTGGG - Intronic
934965715 2:98719941-98719963 TTTTAAAAATAAATCCTGGCTGG - Intronic
935176792 2:100655821-100655843 TTCAGGAAAGAAATGCTGGCTGG + Intergenic
935211355 2:100941699-100941721 CTCTGGAATGAAAACCTTGCGGG + Intronic
937215748 2:120312344-120312366 CTTTAGAAAGAAATCATGGCGGG - Intergenic
937673274 2:124561330-124561352 CTGGAGAAAGAAATCCTTACTGG + Intronic
939196389 2:138978374-138978396 CTCAAGAATGGAACCCTGGCTGG - Intergenic
940278347 2:151963014-151963036 CTCTAGAAAGAAACGTGGGCTGG + Intronic
941422932 2:165305732-165305754 CTTTAGAAAGAAAAGCTGGTAGG + Intronic
942388898 2:175471468-175471490 CTACAAAAAGAATTCCTGGCTGG - Intergenic
943057318 2:182998531-182998553 CTCAAGAATAAAATCCTGGCCGG + Intronic
945287964 2:208101067-208101089 CTCTAAAAATAACACCTGGCTGG - Intergenic
945406255 2:209452360-209452382 CTCTAGAAAGGCATTCTGTCAGG + Intronic
947298628 2:228663155-228663177 TTCTACAAAGAAATCCTGCTGGG - Intergenic
949079653 2:242086765-242086787 CTAGTGAAAGAATTCCTGGCTGG - Intergenic
1169153562 20:3309896-3309918 ATCTATAAAGAATTCCTGGCTGG + Intronic
1171376090 20:24694959-24694981 CTCTCCAAAGGAAGCCTGGCTGG - Intergenic
1171964691 20:31520649-31520671 CTTTAGAAAGAGCTCATGGCAGG + Intronic
1172221699 20:33278583-33278605 ATCTAGAAAAAAATACTGGAAGG - Intronic
1174275315 20:49399355-49399377 CTCAAAAGAGAACTCCTGGCCGG - Intronic
1174874402 20:54211380-54211402 ATCTAGAAAGAAATTCTGCTAGG - Intronic
1177999840 21:28148731-28148753 CACAAGAAAGAAATCCTGGGAGG + Intergenic
1178015972 21:28346510-28346532 CAATAGAAAGAAATCTTGGCTGG + Intergenic
1182780725 22:32865338-32865360 CTCTAGAAAGAAGGTATGGCAGG - Intronic
1184040727 22:41941687-41941709 CTCTGGGAGGAAAGCCTGGCGGG + Intronic
1184540050 22:45116185-45116207 GTATATAAAGAATTCCTGGCCGG + Intergenic
1185212347 22:49577410-49577432 CACCAGATAGAACTCCTGGCAGG + Intronic
949758936 3:7446754-7446776 ATATAAAAAAAAATCCTGGCCGG - Intronic
950230810 3:11274184-11274206 CTCTATAATGAGATGCTGGCTGG - Intronic
950269568 3:11603291-11603313 TCCTTAAAAGAAATCCTGGCTGG - Intronic
951156320 3:19358120-19358142 TACTAGAAAAAAATACTGGCCGG + Intronic
951977586 3:28530255-28530277 ATCAAGAAAGCAATCCCGGCCGG + Intronic
953763445 3:45713081-45713103 CTGTAGAAAGTAAGCTTGGCAGG + Intronic
954657570 3:52205472-52205494 CTCTAGAGGGACATCCTGGATGG - Intronic
954899708 3:54008371-54008393 CTCAAGACGGAAATCCAGGCAGG - Intergenic
955929477 3:64042020-64042042 CTTTAAAAATAATTCCTGGCCGG - Intergenic
956185410 3:66557688-66557710 CTCTAGAATCAAATTCTGTCTGG - Intergenic
956298344 3:67739091-67739113 CTCTACAAAGTAATATTGGCAGG - Intergenic
958049204 3:88322792-88322814 CTCAAGAAAGGAATCCAAGCTGG - Intergenic
958905927 3:99942350-99942372 CTCCAGAAAAAAATAATGGCAGG + Intronic
959188052 3:103072548-103072570 CACTAATAAGAAATCATGGCTGG + Intergenic
959496165 3:107054678-107054700 CTCTAGTTAGAAAACTTGGCTGG - Intergenic
960023615 3:112984106-112984128 CTCTAGAAAGGAATAATGCCTGG - Intergenic
960800455 3:121533808-121533830 TTCTTCAAAGAAATACTGGCTGG - Intronic
960947013 3:122973857-122973879 CTCCAGAAGGAAATCCTGAAAGG - Intronic
960988656 3:123296375-123296397 CTCCAGAAAGCCTTCCTGGCTGG + Intronic
961160488 3:124720280-124720302 TTCTGGAAAGAAAGCCTGCCAGG + Intronic
962566712 3:136667889-136667911 CTCTAGAAAGTAGACCTGGCCGG + Intronic
962665576 3:137650733-137650755 CACCAGAGAGAAATCCTGGCAGG + Intergenic
964340292 3:155701436-155701458 CTGTAGAAAGAGACCCTGGCTGG + Intronic
965388621 3:168076395-168076417 CTAAAAAAATAAATCCTGGCCGG + Intronic
965475197 3:169147652-169147674 CTGGGGAAAGAAATCCTGCCTGG - Intronic
966786677 3:183629099-183629121 CTCCATATAGAATTCCTGGCCGG - Intergenic
967424280 3:189308315-189308337 CACATGAAAGAAATCCTGGGAGG - Intronic
967940891 3:194765543-194765565 CCTTAGAAATAAATTCTGGCCGG - Intergenic
969594955 4:8143597-8143619 CCTGAGAGAGAAATCCTGGCAGG - Intronic
971812643 4:31446875-31446897 CTCTGGAAAGAACAACTGGCAGG - Intergenic
974076791 4:57174224-57174246 TTCTAAAGAGAAATGCTGGCTGG - Intergenic
975359996 4:73458077-73458099 GTCAAGGAAGAAATCCAGGCTGG - Intergenic
975809057 4:78146471-78146493 CTCTAAAAAGTAATCTTGGGAGG - Intronic
977136247 4:93308200-93308222 CTTTAGAAAGAAGATCTGGCCGG + Intronic
977490824 4:97707637-97707659 CACTAGAAAGAAATATTGACTGG + Intronic
978307124 4:107342163-107342185 ATCAAGAAAGCAATCATGGCTGG + Intergenic
978961741 4:114687864-114687886 CTCAAGAAAGAAAGCCTGGTTGG + Intergenic
980806898 4:137827539-137827561 CACTATTAAGAAATTCTGGCTGG - Intergenic
981098221 4:140803402-140803424 CTCAGAAAACAAATCCTGGCTGG - Intergenic
983227110 4:165095550-165095572 TTCTGGAAGGAATTCCTGGCAGG - Intronic
983889187 4:173013436-173013458 CTCTAGAATGAAATCTTCTCTGG + Intronic
984086292 4:175316438-175316460 ATCTATAAAGAAAGCCTGTCGGG - Intergenic
984243643 4:177248291-177248313 TTCTAGAAAGAAGTCTTGGCCGG - Exonic
984387482 4:179081031-179081053 ATTAAGAAAGAAATCATGGCCGG + Intergenic
986708976 5:10473853-10473875 CTCTAGAAAAATTTTCTGGCTGG + Intergenic
987094647 5:14537276-14537298 ATCAAGAATGCAATCCTGGCTGG - Intergenic
987121614 5:14773089-14773111 CTCTAGAAACAAAACCTGTGTGG - Intronic
988082997 5:26436662-26436684 ATTTAAAAAAAAATCCTGGCTGG + Intergenic
990257038 5:53981598-53981620 CTCTTGAAAGAAATCATGCGGGG + Intronic
990390110 5:55310312-55310334 TTTAAGAAAAAAATCCTGGCCGG + Intronic
990420302 5:55625395-55625417 CGCAAGAAAGAATTCCAGGCAGG - Intergenic
990567362 5:57042860-57042882 CCTGAGAAAGATATCCTGGCAGG - Intergenic
991618494 5:68520723-68520745 CTTTAGTAAGAAATCCAGACAGG + Intergenic
992834453 5:80626341-80626363 CTCTGGAAAGAACAACTGGCAGG - Exonic
998027331 5:138829753-138829775 ATCTTGAAAGAAATCTTGGCCGG + Intronic
999326290 5:150645939-150645961 AACTAGGAAGAAATCCTGGGAGG + Intronic
1001263104 5:170249720-170249742 CTCTAGCAAGCAATCAAGGCTGG - Intronic
1001526651 5:172433813-172433835 CTCTAGAAAGGAATCCATGTTGG + Intronic
1001610344 5:172995908-172995930 CTCTAGAAAGAAATCCTGGCTGG - Intronic
1001933442 5:175688671-175688693 CTCTAGGACGAAATGCTGTCTGG + Intergenic
1002046576 5:176544732-176544754 CCCTAGAAAGAACTCGGGGCTGG - Intronic
1003153814 6:3574536-3574558 CTCTAAAAAGACAGGCTGGCCGG - Intergenic
1004349807 6:14881084-14881106 CTGTAGAAAGAGATCCCAGCAGG - Intergenic
1004360164 6:14963947-14963969 CTCTAAAAATGAGTCCTGGCCGG + Intergenic
1004553321 6:16671185-16671207 CTTTAGAAAGAAATTCTGCCAGG + Intronic
1004740931 6:18460164-18460186 CTCCAGAAAGAAATGCAGCCCGG - Intronic
1006646755 6:35520250-35520272 CTCTAGAGAGAAATCTGGACGGG + Intergenic
1007388330 6:41534514-41534536 AGCTAGAAAGAAATCAGGGCTGG - Intergenic
1007618081 6:43194078-43194100 CTCCAGACAGAAGTGCTGGCTGG + Intronic
1009714386 6:67369757-67369779 CTCCAGAAAAGAATTCTGGCAGG - Intergenic
1011379259 6:86724959-86724981 CTCAAGAAACAATTCCTTGCTGG - Intergenic
1012471951 6:99582236-99582258 CTCTAGAAAAAAATTAAGGCTGG + Intergenic
1012686080 6:102251335-102251357 CCATAGAAAGCAATCCTGACTGG - Intergenic
1012877519 6:104745735-104745757 CTGTAATAAGAAATCCTGGCCGG - Intronic
1013251776 6:108341599-108341621 ATCTAGGTACAAATCCTGGCTGG - Intronic
1014242989 6:119038751-119038773 CTCAAGAAAGAATTCAGGGCCGG - Intronic
1015953590 6:138577974-138577996 CTCTAGAAAGAAGTCATGGAAGG + Intronic
1016485509 6:144533184-144533206 TTCTTGAAAGAAAAACTGGCAGG + Exonic
1017868128 6:158462667-158462689 ATCTACAAAGAAAATCTGGCTGG - Intronic
1019996787 7:4729691-4729713 CTTCAAAAAGAAACCCTGGCCGG + Intronic
1021338504 7:19433958-19433980 ATATAAAAAAAAATCCTGGCCGG + Intergenic
1022084092 7:27049535-27049557 CTCAAAAAAAAAATCCAGGCTGG + Intergenic
1022101285 7:27170303-27170325 CTCCCGAAAGAAATCCTGTTTGG + Intronic
1022184621 7:27955052-27955074 AATTAGAAAGAAGTCCTGGCTGG - Intronic
1022294408 7:29036508-29036530 CTGTAGGAAGAAATCCAGCCAGG + Intronic
1022342628 7:29483115-29483137 CTCTAGAAAAAAGTGCAGGCCGG - Intronic
1022367720 7:29741595-29741617 CCCTAGAGAGTAATCCTGGATGG - Intergenic
1022556312 7:31301603-31301625 GTCTAGAAGGAAATCCTGCCTGG + Intergenic
1022794381 7:33720303-33720325 CTCTACTAAGTAATCTTGGCTGG + Intergenic
1022928462 7:35082272-35082294 CCCTAGAGAGTAATCCTGGATGG + Intergenic
1024515808 7:50254522-50254544 ATCAAGAAAGGATTCCTGGCCGG + Intergenic
1026842599 7:73678710-73678732 CTCTAAAAAGAAAAACAGGCCGG - Intergenic
1027142500 7:75668919-75668941 CCCCAAAAAGAAAACCTGGCTGG + Intronic
1027596224 7:80177324-80177346 CTCTAAAAAGATACGCTGGCCGG - Intronic
1029397335 7:100317307-100317329 CTCTAAAAAGAAACTCAGGCTGG + Intronic
1030407003 7:109127846-109127868 CTCTAGAAAGAGGGCTTGGCAGG - Intergenic
1031321476 7:120335066-120335088 GTTTAAAAAGTAATCCTGGCTGG + Intronic
1031640302 7:124154737-124154759 TTCTAAAAAAAAATCCTGACTGG + Intergenic
1032060254 7:128718134-128718156 TTCAAGAAAGAAATTTTGGCTGG + Intronic
1033148061 7:138888149-138888171 CTCAGGAATGAAAGCCTGGCAGG + Intronic
1033332452 7:140427883-140427905 TTCTAGAAAGAAATTGTGCCAGG - Intergenic
1034649915 7:152682030-152682052 CTTTAGGAAAAAATCTTGGCTGG - Intergenic
1034899314 7:154897681-154897703 TTCTAGAAAGGATCCCTGGCTGG - Intergenic
1035872266 8:3148723-3148745 CCCTAGAAAGAACTCCTACCAGG + Intronic
1036164385 8:6418874-6418896 CTTAAAAAAAAAATCCTGGCCGG - Intronic
1036475685 8:9091222-9091244 CACAAGAAAGAATTCTTGGCCGG + Intronic
1037207885 8:16346329-16346351 CTCTTGCAAGAAAACGTGGCGGG - Intronic
1037246834 8:16845008-16845030 GGCCAGAAAGAAATCCTGGCTGG - Intergenic
1038049572 8:23796176-23796198 CTCAAGATACAAGTCCTGGCGGG - Intergenic
1039808768 8:41026390-41026412 CCTTATAAAGAAATCTTGGCTGG + Intergenic
1043086759 8:75844423-75844445 CTTTAGTAAAAAATGCTGGCTGG + Intergenic
1043589781 8:81816490-81816512 GTGTATCAAGAAATCCTGGCTGG - Intronic
1044803219 8:95978310-95978332 CTCAAGAAAGGTATCCAGGCTGG - Intergenic
1045119229 8:99016883-99016905 ATATATAAAGAATTCCTGGCCGG - Intronic
1045257331 8:100538008-100538030 TTCTAGAAACATATTCTGGCAGG - Intronic
1045774429 8:105785605-105785627 CCAAAGAAAGAACTCCTGGCTGG + Intronic
1046301496 8:112298186-112298208 CTCTACAAAGAGATTCTGGTGGG - Intronic
1047013391 8:120696967-120696989 CTTTAGAGAGAACTCCTGGAAGG + Intronic
1051755633 9:20396725-20396747 ATCTAGAAAGAAATGCATGCAGG + Intronic
1052458557 9:28732859-28732881 CTGATGCAAGAAATCCTGGCCGG + Intergenic
1053385624 9:37685048-37685070 TTCTTGAAAGACATCTTGGCTGG - Intronic
1053581000 9:39403913-39403935 CTTAATAAAGAAGTCCTGGCTGG - Intergenic
1053845491 9:42231967-42231989 CTTAATAAAGAAGTCCTGGCTGG - Intergenic
1054102587 9:60962717-60962739 CTTAATAAAGAAGTCCTGGCTGG - Intergenic
1054583774 9:66944152-66944174 CTTAATAAAGAAGTCCTGGCTGG + Intergenic
1055158155 9:73089916-73089938 CTCTAGAAAGGTATGCAGGCTGG + Intergenic
1056207281 9:84332598-84332620 CTCTGGAAAGAACAACTGGCAGG + Intronic
1056454230 9:86744915-86744937 CTCTAGAAAGGATTTCTGGAAGG - Intergenic
1057078366 9:92153358-92153380 ACCTAGAGAGAAAGCCTGGCTGG + Intergenic
1059744409 9:117186248-117186270 TACTAAAAATAAATCCTGGCCGG + Intronic
1059865691 9:118511564-118511586 CTCTTGATAGAAATGATGGCGGG - Intergenic
1061327528 9:129873378-129873400 CTTAAGAAATAAAACCTGGCTGG - Intronic
1185602153 X:1347740-1347762 CTTTAGAAAAAAATTGTGGCCGG + Intronic
1185636709 X:1557463-1557485 CTCTAGAAAGAAAAGTTAGCTGG - Intergenic
1186841819 X:13492134-13492156 ATCAAGAAGGAAATACTGGCTGG - Intergenic
1186902172 X:14068443-14068465 CTCTAGAAAAGAATCCTTCCTGG + Intergenic
1187175684 X:16894378-16894400 TTCTAGAAAGAAATGTTGGCTGG - Intergenic
1187774394 X:22739195-22739217 ATTTAAAAAGAACTCCTGGCCGG - Intergenic
1189273746 X:39770046-39770068 CTCAAGAAAAACATCCAGGCTGG + Intergenic
1189889429 X:45583784-45583806 CTCTAAAAAGAAATCTTGCCTGG - Intergenic
1190865620 X:54382235-54382257 CTGTAAAAAGAACTCCAGGCTGG + Intergenic
1192407850 X:70905004-70905026 CTCAAGAAATAAATCAAGGCCGG + Intronic
1192925095 X:75747658-75747680 CTCTAGCAAGATATTCTGGGAGG + Intergenic
1193611813 X:83640706-83640728 CTCTAGAAAGACTTCACGGCTGG - Intergenic
1196819305 X:119690426-119690448 CATTAAAAAGAATTCCTGGCCGG + Intronic
1198673383 X:139105775-139105797 CTTTAGAATGCATTCCTGGCTGG + Intronic
1199199630 X:145071734-145071756 CTTAAAAAAGAAATCCTGGCCGG - Intergenic
1199714594 X:150497579-150497601 CTCACTAAAGAAATTCTGGCTGG - Intronic
1201727338 Y:17168305-17168327 CTCTAGAAAGAGATTAAGGCTGG - Intergenic