ID: 1001611603

View in Genome Browser
Species Human (GRCh38)
Location 5:173007345-173007367
Sequence ATGTGCTTATAGAACTGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001611601_1001611603 15 Left 1001611601 5:173007307-173007329 CCTCTTCCAAGCTCTCGTGGCTG 0: 1
1: 1
2: 8
3: 61
4: 362
Right 1001611603 5:173007345-173007367 ATGTGCTTATAGAACTGAGATGG 0: 1
1: 0
2: 1
3: 12
4: 161
1001611599_1001611603 18 Left 1001611599 5:173007304-173007326 CCTCCTCTTCCAAGCTCTCGTGG 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1001611603 5:173007345-173007367 ATGTGCTTATAGAACTGAGATGG 0: 1
1: 0
2: 1
3: 12
4: 161
1001611602_1001611603 9 Left 1001611602 5:173007313-173007335 CCAAGCTCTCGTGGCTGTCAGAA 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1001611603 5:173007345-173007367 ATGTGCTTATAGAACTGAGATGG 0: 1
1: 0
2: 1
3: 12
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001611603 Original CRISPR ATGTGCTTATAGAACTGAGA TGG Intronic
900844001 1:5081667-5081689 AAGTGCTCATGGAACAGAGAAGG + Intergenic
902122890 1:14182984-14183006 CTGTGGGTATGGAACTGAGAGGG - Intergenic
902992919 1:20202099-20202121 GTGGAGTTATAGAACTGAGAGGG - Intergenic
903957472 1:27035267-27035289 TTGTGCTTGTAGAACAGAAAAGG - Intergenic
905149319 1:35914768-35914790 GTGTGCTTACAGAAATGTGAGGG - Intronic
905679123 1:39854353-39854375 TTGTGCTTATTGAACTGATTTGG - Intronic
907021453 1:51070253-51070275 ATGGGCTTATATAACAGGGAAGG - Intergenic
908671247 1:66550049-66550071 AGGTGCTTATAGAGCAGAGTGGG - Intronic
909469140 1:76007033-76007055 ATCTCCTTAGAGGACTGAGATGG - Intergenic
909822190 1:80079902-80079924 ATGTGCTTATAGAGCTAAGTAGG + Intergenic
910053409 1:83003550-83003572 ATGTGATTATAGGACTCAGTTGG + Intergenic
910485975 1:87714092-87714114 ATTTGCATATAGAACTGTTAAGG + Intergenic
911128279 1:94361866-94361888 ATGTCATTATACAGCTGAGATGG - Intergenic
911443252 1:97956679-97956701 AAGTTCTGATAGACCTGAGAAGG + Intergenic
915191298 1:154153150-154153172 ATGTGTTTCTAGTAATGAGAGGG + Intronic
916432037 1:164739574-164739596 ATCTGCTTTTAGAAATGAAAGGG - Intronic
916567043 1:165990026-165990048 ATGTCCTTCTATAAGTGAGAGGG + Intergenic
917615052 1:176734153-176734175 AAGAGCTTATAGAACTTGGAAGG - Intronic
918549541 1:185726143-185726165 ATATGCTTAAAGTACTCAGATGG + Intergenic
919415067 1:197297766-197297788 AGGAGCCTATAGAACTTAGAGGG + Intronic
919702374 1:200643908-200643930 ATGTGCTTGTGGAACTGTGGGGG + Intronic
921570593 1:216773797-216773819 ATGCACTTTTAGAAATGAGAAGG + Intronic
1064004022 10:11686250-11686272 ATGTGTTTATAGATTTGAGGTGG - Intergenic
1064498881 10:15946804-15946826 ATCTGCATATAGAAATGGGATGG + Intergenic
1066555955 10:36613029-36613051 ATGAGTATATAGAAATGAGAGGG - Intergenic
1071412026 10:85406495-85406517 ATGTCCTCCTAGAACTGACAGGG - Intergenic
1072504664 10:96053125-96053147 ATTTGCTTCTAGAACTTACAAGG - Intronic
1073562257 10:104506856-104506878 ATGTAATTAGAGAACTGGGAGGG - Intergenic
1074523013 10:114241723-114241745 ATGTAATTATAGCAATGAGAGGG + Intronic
1078130312 11:8608941-8608963 ATATGCTTTGAGAAATGAGAGGG - Intergenic
1078853388 11:15185207-15185229 ATGTGATTACATAACTTAGAAGG + Intronic
1080930978 11:36810143-36810165 ATCTGCTTATATTACTGAGTTGG - Intergenic
1081115690 11:39196567-39196589 ATGTTCTTAAAGAACTGTGATGG - Intergenic
1085136213 11:74091232-74091254 TTATGTTTATAGAATTGAGATGG + Intronic
1085807948 11:79653752-79653774 TCTTGCTTATAGACCTGAGATGG - Intergenic
1086409947 11:86535060-86535082 TTTTGATTATTGAACTGAGAGGG - Intronic
1087033997 11:93737830-93737852 TTGTGTTTAAAGACCTGAGATGG + Intronic
1087257899 11:95977513-95977535 ATGTGAGCATAGAACTGAAAGGG + Exonic
1087437229 11:98136604-98136626 ATGTGCAGAAAGACCTGAGAGGG - Intergenic
1087491034 11:98827605-98827627 ATGTGTTTCCATAACTGAGAAGG - Intergenic
1088416879 11:109599198-109599220 ATGTGTATATATAACAGAGATGG + Intergenic
1090000281 11:122950284-122950306 ATGTCCTTATAGAAATAATACGG - Intronic
1092675089 12:10907888-10907910 ATGTGTTGAGAGAATTGAGAGGG - Intronic
1093583659 12:20811504-20811526 ATGTACCTATGGAACTGAGGAGG - Intronic
1093941056 12:25055101-25055123 ATGTGCTGATGCAACTTAGATGG - Intronic
1095445497 12:42278174-42278196 ATTTGTAGATAGAACTGAGAAGG - Intronic
1095513497 12:42979700-42979722 TTGTGCCATTAGAACTGAGAAGG + Intergenic
1096253137 12:50046192-50046214 ATGTGTTTATGGAACTGGCAGGG - Intergenic
1098678493 12:73321232-73321254 AGCTGCTTATAGAAGTGATAAGG + Intergenic
1099154105 12:79152946-79152968 ATTTTCTTATATAAATGAGAAGG - Intronic
1099246584 12:80199999-80200021 ATGTGCTTATAGAGCTCAGTGGG - Intergenic
1102842180 12:116136752-116136774 ATATGATTATAAAACTGAAATGG - Intronic
1103827908 12:123754808-123754830 AGGGGCTTTGAGAACTGAGACGG + Intronic
1104397447 12:128446531-128446553 AGTTGATTAAAGAACTGAGATGG - Intronic
1106210325 13:27637018-27637040 ATGTGATGATATAACTAAGAAGG - Intronic
1107959952 13:45548644-45548666 ACATGCTGATAGGACTGAGAGGG + Intronic
1108437261 13:50412962-50412984 ATGTGCCTCTAGAAGTGAAATGG - Intronic
1110917113 13:81034619-81034641 ATTGGCTTATAGAGGTGAGATGG - Intergenic
1111268252 13:85848329-85848351 TTGTTCTTACAAAACTGAGAAGG - Intergenic
1112883892 13:104144674-104144696 ATGTCCTTATATACATGAGATGG - Intergenic
1113037319 13:106064502-106064524 TTGTATTTATAAAACTGAGATGG - Intergenic
1115076196 14:29393989-29394011 ATGTCCTTATAGCTCAGAGAAGG + Intergenic
1116400018 14:44495275-44495297 TTGTGCTAATAGAAGTGTGAGGG - Intergenic
1131703801 15:94970873-94970895 GTGTGCTGATAGAAGTGAGTGGG + Intergenic
1134140573 16:11714723-11714745 ATTTGCTTGTAGAACTGAGTCGG - Intronic
1135852510 16:25977375-25977397 ATGTGCTCAGAGAACTAAAAGGG - Intronic
1137863215 16:51867837-51867859 ATGTGCTTATGCAAATTAGAGGG + Intergenic
1139767863 16:69247279-69247301 ATATGATTATAGAACTAGGAGGG - Intronic
1140632659 16:76872807-76872829 CTGTTCTTATAGCACTGGGAAGG + Intergenic
1140665092 16:77220278-77220300 ATTTGAGTATAGCACTGAGATGG + Intergenic
1142008091 16:87699833-87699855 ATGTGCTTCTACAAGTGAAAAGG - Intronic
1142442429 16:90107762-90107784 GTGTCCTTATAAAACTTAGATGG + Intergenic
1142607943 17:1092270-1092292 ATGTGGTTCTAGGACTCAGAAGG + Intronic
1144915306 17:18719389-18719411 ATGCCCTAATAGAACTCAGAGGG - Intronic
1144938633 17:18920178-18920200 ATGTGCTTACAGGACTGAAGAGG - Intronic
1145933169 17:28700334-28700356 GTGTGCTTACAGATCTGACACGG + Exonic
1149138707 17:53402914-53402936 TTTTGCTTTCAGAACTGAGAAGG + Intergenic
1151363859 17:73604726-73604748 ATGTGGGTATAGAAATGAGGAGG + Intronic
1154272665 18:12933333-12933355 ATGTGCTGCTAGAATGGAGAAGG - Intergenic
1158334650 18:56402732-56402754 ATGTCCTTATGAAACGGAGAAGG + Intergenic
1159684276 18:71398228-71398250 AAGTGCTTACAGAACATAGAAGG + Intergenic
1164422102 19:28103446-28103468 ATGTCCTTCTAGAGCTGAGATGG + Intergenic
925522793 2:4766360-4766382 CTGTGGTTCTAGAATTGAGATGG + Intergenic
926710515 2:15875803-15875825 ATGTGCTTAGCTCACTGAGATGG - Intergenic
926958010 2:18322946-18322968 CTGTACTTTAAGAACTGAGATGG - Intronic
927093822 2:19732626-19732648 ATGTGCATGTAAAATTGAGAAGG + Intergenic
927977541 2:27350455-27350477 AAGTGCTTATCAAACTGGGAAGG + Intronic
931838877 2:66128159-66128181 AGGTGAGTTTAGAACTGAGAAGG - Intergenic
933033387 2:77361194-77361216 ATGTGCTAAGAGAAGTGAGTGGG - Intronic
939135841 2:138292083-138292105 ATGGCCTAAGAGAACTGAGAGGG - Intergenic
939918029 2:148072607-148072629 ATGTGCCTAAAGAACTGAAGAGG - Intronic
943683582 2:190793120-190793142 ATGAGCTCATAGAACTGAGAGGG - Intergenic
943935411 2:193908930-193908952 GTGTACTTAAACAACTGAGATGG + Intergenic
946847151 2:223869555-223869577 CTGTCCTTATAGAAGTTAGAGGG + Intronic
947165732 2:227259948-227259970 ATGTGCTTATGGAATTGACATGG + Intronic
1170079566 20:12457516-12457538 ATGTACTTAAAAAACTGAGTTGG + Intergenic
1173029174 20:39338817-39338839 ATATGCTTACAGAAATGCGAAGG - Intergenic
1174706106 20:52657807-52657829 ATGTGGCTATAGAAGTGAGAGGG + Intergenic
1179772991 21:43637861-43637883 ATGCGTTTATAAAATTGAGAAGG - Intronic
1182751122 22:32643022-32643044 ATGAGCTTATAAAAGTGATAGGG + Intronic
951159734 3:19403645-19403667 ATGTGCTTATAGAAAAGCGCAGG + Intronic
954234333 3:49244675-49244697 ATTGGCTTCTTGAACTGAGATGG - Exonic
954533630 3:51341702-51341724 ATTTACTTAAAGAACTGATACGG + Intronic
955459394 3:59163947-59163969 ATGTGCTAAGAGAAATCAGAAGG - Intergenic
959565997 3:107833853-107833875 ATGTGCTTTCAGAACTGCGTGGG - Intergenic
961528206 3:127521790-127521812 GTGTCCTTATACAACTTAGATGG - Intergenic
962686348 3:137851671-137851693 TTGGGCTTGAAGAACTGAGAAGG - Intergenic
962877281 3:139544901-139544923 ATGTGATTAAAGATCTAAGATGG - Intergenic
965157995 3:165089200-165089222 ATGTCCTTCTAGAATTCAGACGG + Intergenic
965943616 3:174213041-174213063 AGTTGCTTATAGAATTAAGATGG - Intronic
966210318 3:177446412-177446434 ATGTATTTAGGGAACTGAGAGGG + Intergenic
968362701 3:198158722-198158744 GTGTCCTTATAAAACTTAGATGG + Intergenic
969094344 4:4720532-4720554 CTGTGCTGATAGAAGGGAGAGGG - Intergenic
971470830 4:27024767-27024789 TTGTGCATAAAGAACTGAAAAGG + Intronic
971687813 4:29791871-29791893 ATGTGCTGTTCCAACTGAGAGGG + Intergenic
974628098 4:64449620-64449642 GTCTGCTTACAGAACTGGGATGG + Intergenic
978267464 4:106843564-106843586 ATGTGTCCATAGAAGTGAGATGG + Intergenic
978770819 4:112455042-112455064 TTGTGGTTGTAGAACTGAGGTGG + Intergenic
981418633 4:144523151-144523173 ATGTACTTACAGGAATGAGAAGG - Intergenic
982454232 4:155588834-155588856 ATGTGCAGTTAGAACTGAAATGG - Intergenic
984041251 4:174736651-174736673 ATTTGTTTATAGAAGTGTGAAGG + Intronic
984057667 4:174949378-174949400 ATCTGCTTAGAGAAATGACACGG - Intronic
987164617 5:15182753-15182775 ATGTTTTGATAAAACTGAGAGGG - Intergenic
987822024 5:22977826-22977848 TAGTGCTTATAGAAGTTAGAGGG + Intergenic
988809778 5:34773002-34773024 ATTTGCTTATAAAACTCAGCTGG - Intronic
991603927 5:68381384-68381406 ATGTCCTTATAGAACTTTGTTGG - Intergenic
992866691 5:80963406-80963428 ATGTGCTTAAAGAAATAACACGG - Intronic
993012674 5:82501332-82501354 ATGGTCTTATAGAATTGAAATGG - Intergenic
993151170 5:84164072-84164094 ATATGCAGATACAACTGAGAGGG + Intronic
996085787 5:119303765-119303787 ATGTGACTAAAGAACTGGGAAGG - Intronic
997121419 5:131176964-131176986 AGGTGCTAGTAGAACTGTGAGGG - Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
1001131525 5:169068143-169068165 TTGTACTTTTACAACTGAGAGGG - Intronic
1001611603 5:173007345-173007367 ATGTGCTTATAGAACTGAGATGG + Intronic
1002599660 5:180346972-180346994 ATCTCCTTGCAGAACTGAGAGGG + Intronic
1003735150 6:8869715-8869737 CTGTTCTTATGGAACTGAGCTGG + Intergenic
1007077528 6:39077459-39077481 ATGTGCTGAGAGAACTCAGAAGG - Intronic
1008146161 6:47894076-47894098 ATGGGCTGATAGAACTCAGCTGG - Intronic
1008929804 6:56926835-56926857 ATGTACTTGAAGAACTTAGAAGG + Intronic
1009943006 6:70311001-70311023 ATGTGCATATGGAAGGGAGAAGG - Intergenic
1012859515 6:104542844-104542866 ATTTGCTTATAGAATTGGGAGGG - Intergenic
1014044835 6:116873757-116873779 ATGTGGTTATATAATTGAAAAGG + Intergenic
1014779198 6:125543719-125543741 ATGAGCTTTTAGACCTAAGAAGG - Intergenic
1018568697 6:165184585-165184607 ATGTGGTTTTGGAACTCAGAAGG - Intergenic
1018688921 6:166327771-166327793 ATGTGGTTATAGAGTTCAGATGG - Intronic
1019252982 7:29989-30011 GTGTCCTTATAAAACTTAGATGG - Intergenic
1021476763 7:21070509-21070531 ATGTTTTTTCAGAACTGAGATGG + Intergenic
1021916413 7:25437721-25437743 ATGTGCTCATACAAATGAGCTGG - Intergenic
1030250974 7:107444169-107444191 AGAGACTTATAGAACTGAGAGGG - Intronic
1031608980 7:123802755-123802777 ATCTGCTTATAAAAATAAGATGG + Intergenic
1036062277 8:5337067-5337089 GTGTACTTACAGAACTTAGATGG - Intergenic
1039023473 8:33232349-33232371 ATGTGCTTATACAAATGATGGGG + Intergenic
1041447542 8:57969327-57969349 TTGTGCTTACAGAACTCAGCTGG - Intergenic
1042363188 8:67905953-67905975 ATGTGCTTACATAATTGTGAAGG - Intergenic
1042575026 8:70208226-70208248 ATCTTCTCATAGAATTGAGAGGG - Intronic
1044208088 8:89515844-89515866 ATTTGGGTATAGGACTGAGAGGG - Intergenic
1044889390 8:96816879-96816901 ATCTGTTTATAGAACAGATATGG - Intronic
1045982979 8:108213755-108213777 AAGTGCTAATAAAACTGTGAAGG + Intronic
1046426401 8:114056816-114056838 ATGTGCATTTAGAACTGGGATGG - Intergenic
1046961598 8:120119305-120119327 ATGTGCTGGGAGAACTGATATGG - Intronic
1047567545 8:126062274-126062296 GTGTGTTTATAGGACAGAGACGG - Intergenic
1050169942 9:2804800-2804822 TTGAGCTTATAGTCCTGAGATGG - Intronic
1055852388 9:80647819-80647841 ATGGACAAATAGAACTGAGAGGG - Intergenic
1059463678 9:114451711-114451733 AGGTTCTTACAGAACTTAGATGG - Intronic
1060066761 9:120508759-120508781 CTGTGCTAATAGACCAGAGAGGG - Intronic
1060404101 9:123364607-123364629 TTGTGCTCAATGAACTGAGAAGG + Intronic
1061436395 9:130565398-130565420 TTGTGATTCTAGAACTGAGATGG + Intergenic
1061544218 9:131294546-131294568 ATGGGCTTAGTGAACTGGGATGG - Intronic
1062747388 9:138222385-138222407 GTGTCCTTATAAAACTTAGATGG + Intergenic
1188076846 X:25787572-25787594 ATGTGTTTAGAGAACGGTGAAGG + Intergenic
1188791447 X:34412437-34412459 AGGTGTTTGTAGAACTCAGACGG - Intergenic
1195742043 X:108074679-108074701 TTATGCTTATAGAACTGGGATGG + Intronic
1197514612 X:127410806-127410828 ATGTGCTTATAAAAATGGGTGGG - Intergenic
1198634899 X:138686322-138686344 CTGTGCTTATAAAAGTGAAATGG + Intronic
1198846149 X:140913494-140913516 AAGTGCTTATAAAAATAAGATGG + Intergenic