ID: 1001614172

View in Genome Browser
Species Human (GRCh38)
Location 5:173029095-173029117
Sequence ATAGAAAAACAGCTCCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 276}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001614172_1001614176 27 Left 1001614172 5:173029095-173029117 CCCTGTGGGAGCTGTTTTTCTAT 0: 1
1: 0
2: 1
3: 34
4: 276
Right 1001614176 5:173029145-173029167 GAGGTGTATAGTACTGAAGTAGG 0: 1
1: 0
2: 0
3: 7
4: 95
1001614172_1001614175 8 Left 1001614172 5:173029095-173029117 CCCTGTGGGAGCTGTTTTTCTAT 0: 1
1: 0
2: 1
3: 34
4: 276
Right 1001614175 5:173029126-173029148 AAAATACTTGAGTGCTTGTGAGG 0: 1
1: 0
2: 0
3: 13
4: 219
1001614172_1001614177 28 Left 1001614172 5:173029095-173029117 CCCTGTGGGAGCTGTTTTTCTAT 0: 1
1: 0
2: 1
3: 34
4: 276
Right 1001614177 5:173029146-173029168 AGGTGTATAGTACTGAAGTAGGG 0: 1
1: 0
2: 0
3: 8
4: 115
1001614172_1001614178 29 Left 1001614172 5:173029095-173029117 CCCTGTGGGAGCTGTTTTTCTAT 0: 1
1: 0
2: 1
3: 34
4: 276
Right 1001614178 5:173029147-173029169 GGTGTATAGTACTGAAGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001614172 Original CRISPR ATAGAAAAACAGCTCCCACA GGG (reversed) Intronic
901351415 1:8600355-8600377 AAAGAAAAACAGCTGGCAAATGG - Intronic
902680566 1:18041205-18041227 CTAGAAAAACAGGAACCACAAGG + Intergenic
905720657 1:40197985-40198007 AAAGAAAAACAGCTCTTCCATGG - Intronic
907010040 1:50954374-50954396 ATAGAAAAACAGGTAACACCAGG + Intronic
907054199 1:51349900-51349922 TTAAAAACACAGCTCTCACAAGG - Intergenic
907342999 1:53750445-53750467 ATGGAAAAGCACCTGCCACAGGG - Intergenic
907727864 1:57036802-57036824 ATGGAAATAAAGTTCCCACAGGG + Intronic
908247268 1:62237710-62237732 ATCGAAACAAAGCTCCCAAATGG + Exonic
908408088 1:63834721-63834743 AAAGCACAAGAGCTCCCACATGG - Intronic
911221718 1:95254310-95254332 ATAGAAAAACAGGTCGGGCATGG + Intergenic
911224213 1:95287084-95287106 AAAAAAAAGCAGCTCCCAGAGGG - Intergenic
911809112 1:102251369-102251391 ATAGAAAAAGAGCACTCACTGGG + Intergenic
912274177 1:108239253-108239275 AACCAAAAACAGCTGCCACATGG + Intronic
912287090 1:108380609-108380631 AACCAAAAACAGCTGCCACATGG - Intronic
912294042 1:108455070-108455092 AACCAAAAACAGCTGCCACATGG - Intronic
914762650 1:150611590-150611612 ATAGAAAAACAGAAACCAGATGG - Intronic
915221101 1:154375341-154375363 AAAAAAAAAAAGCTCCCACCTGG + Intergenic
916286461 1:163110478-163110500 ATAGAAAAAGAGCCTTCACATGG + Intergenic
916646116 1:166786682-166786704 ATAGATAAACACCTATCACAGGG + Intergenic
917431218 1:174971554-174971576 CTAGATAAAAAGCTCCCAAAGGG - Intronic
923078911 1:230635430-230635452 ATAGAACAAGAGGTCCCACTGGG - Intergenic
924586441 1:245365077-245365099 ACAGAAAAACAGGTCCCAGAGGG - Intronic
1063408968 10:5822007-5822029 ATCCAAAAACACCTCCCACCAGG + Intronic
1065923695 10:30416810-30416832 ATAGAAAAAAAGCATCCACTTGG - Intergenic
1071549458 10:86555367-86555389 TTATTAAAACAGCTCCCACTGGG - Intergenic
1072947520 10:99823613-99823635 ATGGAAAAGCAGCTTACACAGGG - Intronic
1073006463 10:100329239-100329261 ATATACCAACAGCTCCCTCAGGG + Exonic
1075956565 10:126528411-126528433 CTTGAAAAACAGGTCCAACAGGG + Intronic
1075977741 10:126710608-126710630 TTAGAAGAACAGATACCACAGGG + Intergenic
1076136969 10:128051833-128051855 ACAAAAAAGCAGCTCCCCCAGGG - Intronic
1076359549 10:129877492-129877514 AAAAAAAAAAAGCTTCCACATGG + Intronic
1076691375 10:132225352-132225374 AAGGAAAAACAGCTGCCACGGGG + Intronic
1077410285 11:2400660-2400682 GCAGAACTACAGCTCCCACAAGG - Exonic
1077587983 11:3469129-3469151 ATGGAAAAACAGCTCCCTCTGGG + Intergenic
1078707431 11:13758702-13758724 ATAGAATAAGAGTTCCCACTGGG + Intergenic
1079529984 11:21439978-21440000 GTAGAATAAAAGCTCCCAAAAGG - Intronic
1080007343 11:27424124-27424146 TTAGAAAATAAGCTCCTACAAGG + Intronic
1080323748 11:31045802-31045824 AAAGAAAAACATCTCCCAATTGG - Intronic
1080602081 11:33829968-33829990 ATAGAACACCAGTTCCCTCAAGG + Intergenic
1080937738 11:36881685-36881707 GTAGACCAACTGCTCCCACAGGG + Intergenic
1081202613 11:40236098-40236120 AAAAAAAAACAGCTACCACAAGG + Intronic
1084243679 11:67840767-67840789 ATGGAAAAACAGCTCCCTCTGGG + Intergenic
1085511524 11:77090687-77090709 AAAGAGAAACAGCTACCACCTGG - Intronic
1086898366 11:92339050-92339072 AGAAAAAAACAACTCCCAAAAGG - Intergenic
1086912305 11:92487236-92487258 ATAGAAAAACATCACCTGCATGG - Intronic
1087724308 11:101700358-101700380 ATGGAAAAGCAGCTTACACAGGG + Intronic
1088767660 11:112999618-112999640 AGAGGAAACCAGGTCCCACATGG + Intronic
1089220769 11:116869644-116869666 TAAGAAAATCAACTCCCACAAGG + Intronic
1091328252 11:134708678-134708700 ATAGAAAAACAAATACCAAATGG - Intergenic
1092414228 12:8277881-8277903 ATGGAAAAACAGCTCCCTCTGGG + Intergenic
1092572649 12:9741788-9741810 CTAGAAAATCAGCTCCCTGAAGG - Intergenic
1093857271 12:24121015-24121037 AGAGAAAAACAGCACCAACTAGG + Intergenic
1094670150 12:32562334-32562356 ATAGAAACACTTTTCCCACATGG - Intronic
1096500975 12:52063625-52063647 ACAGAAAAACAGCTCCCCAGTGG + Intergenic
1096754691 12:53789236-53789258 AAAGAGAAACAGCAGCCACAAGG + Intergenic
1097330873 12:58331610-58331632 ATGGAAAAGCAGCTTACACAGGG - Intergenic
1097718667 12:62996759-62996781 ATAGAAAACAAGGTCCCAGAGGG + Intergenic
1098549680 12:71749468-71749490 AGAGAGAAATAGCTTCCACAGGG - Intergenic
1100925660 12:99545165-99545187 ATAGAAATAGAGCTCCCTCATGG - Intronic
1101144293 12:101826937-101826959 AAAAAAAAACAACTCCCACAGGG - Intronic
1102246471 12:111359639-111359661 AGAGAAAAACAGCTCCAAGAGGG - Intergenic
1102626952 12:114242838-114242860 TTAGAATAACAGATCCCAAAGGG - Intergenic
1105584467 13:21731095-21731117 ATAGAGAAAAATCACCCACAAGG - Intergenic
1106570262 13:30920764-30920786 CTAGATAATCAGCTCCCACAAGG - Intronic
1107288271 13:38821820-38821842 ATAGACAAACAGCTCCAACAAGG + Intronic
1107329348 13:39282048-39282070 TTAGAAAAACTGCTCTGACAGGG - Intergenic
1107666450 13:42695586-42695608 ATAGAATGAGAGCTCCCACTGGG + Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1110304763 13:73972804-73972826 ATATAAATCCAGCTCTCACACGG - Intronic
1111195240 13:84867761-84867783 CTAGACAAACAGGTCCTACATGG + Intergenic
1114385144 14:22246526-22246548 ATATAAAAACAGTTTCCAGATGG - Intergenic
1115787965 14:36847631-36847653 ATAGAAATCCACCTCCCAGAGGG - Intronic
1117779320 14:59216101-59216123 AGAGAAAATCAGCTCAAACAGGG - Intronic
1118849040 14:69570978-69571000 AGAGAAACACAGCTCCTCCAAGG - Exonic
1119119109 14:72056980-72057002 ATACAAAAATATATCCCACAAGG - Intronic
1120758024 14:88262377-88262399 AGAGAAAAGCAGTTCCCACGAGG - Intronic
1121337189 14:93084671-93084693 TTAGCAAAACACCTGCCACATGG + Intronic
1122518229 14:102323546-102323568 ATAGCAAAACACCTACCAAAGGG - Intronic
1123031641 14:105454591-105454613 AAAGAAAAACAACTGCCAGAAGG - Intronic
1124052036 15:26205757-26205779 ATAGAAGGAGAGCTCCCACTGGG + Intergenic
1124873880 15:33572532-33572554 ATGGCAAAACAGCTCCAACAGGG - Intronic
1125388919 15:39171090-39171112 ATAATAAAATACCTCCCACATGG + Intergenic
1126340459 15:47635408-47635430 ATATTAAAACAGCTCCCAATAGG + Intronic
1126546272 15:49877718-49877740 AAACAATAACACCTCCCACATGG + Intronic
1130617836 15:85429331-85429353 CCTGAAAAACAGCTCCCAGATGG - Intronic
1132721358 16:1317775-1317797 ATAGAGAAACAGCTTCCAGATGG + Intronic
1133355422 16:5133100-5133122 ATGGAAAAACAGCTCCCTCTGGG + Intergenic
1137946633 16:52739149-52739171 ATTGAAAACCAGATGCCACATGG + Intergenic
1138456362 16:57123341-57123363 ATAGAGCAACAACTCCCCCATGG + Intronic
1138482304 16:57311595-57311617 AAACAAAAACAGTTCCTACAGGG - Intergenic
1139143951 16:64302049-64302071 ATAGAAAAATACCTGCCACATGG + Intergenic
1139314893 16:66059698-66059720 ATGGAAAAAGACCTCCCAAAAGG + Intergenic
1141063477 16:80896061-80896083 AAAAAAAAAGAGTTCCCACAAGG + Intergenic
1142265573 16:89062702-89062724 ATAGAAACACAGGGCCCAAAGGG + Intergenic
1143890301 17:10097638-10097660 ATAGAAGCACAGAGCCCACATGG - Intronic
1143984598 17:10900924-10900946 ATACATAAAAAGATCCCACAAGG + Intergenic
1144078007 17:11736340-11736362 ATAGAGAAACAGATCCCAATGGG + Intronic
1144331616 17:14229358-14229380 ACAGAAAAACTGCTGTCACATGG - Intergenic
1144353531 17:14422529-14422551 AAAGAAAAACAGCTCCTCTATGG - Intergenic
1144535037 17:16080119-16080141 ATAAAAAAACAGCCCCTACTTGG + Intronic
1145040108 17:19571421-19571443 ATAGAAAACCAGCTGCCCCTGGG - Intronic
1145362797 17:22226117-22226139 TCAGAAAAACAGCTTTCACAGGG - Intergenic
1146379986 17:32321258-32321280 AGGGAAAAGCAGCACCCACAGGG + Exonic
1147228066 17:38996328-38996350 TTAGGAAAGCAGCTGCCACAAGG - Intergenic
1149987593 17:61359382-61359404 ATAGAATGAGAGCTCCCACTGGG + Intronic
1152222018 17:79074123-79074145 ATAGGACACCAGCTTCCACATGG + Intergenic
1153098917 18:1441664-1441686 ATAGAATAAAAGATTCCACATGG + Intergenic
1153984951 18:10343568-10343590 GTAGAGAAACAGCACACACAAGG + Intergenic
1155429670 18:25742460-25742482 ATAGAAAAATCGCTCCCAATGGG + Intergenic
1155993195 18:32302609-32302631 ATAGAAAGACAAATACCACATGG + Intronic
1157542113 18:48518399-48518421 AGAGCAGAACAGCTTCCACAGGG + Intergenic
1157954574 18:52082383-52082405 GAAGAAAAACAGCTCTCAGAAGG - Intergenic
1158773592 18:60551712-60551734 ATAGACAAAGAACTCACACAGGG + Intergenic
1159726913 18:71972156-71972178 ATACACAATCACCTCCCACAAGG + Intergenic
1162463726 19:10828948-10828970 CTGGAAAAACATCTCTCACAGGG - Intronic
1162593792 19:11611669-11611691 ATAGAATAAGAGCTCCCGCTGGG + Intronic
1163099492 19:15085775-15085797 ACAGAAAGACAGATACCACATGG - Intergenic
1163401044 19:17092855-17092877 ATATAAACACAGCACACACATGG - Intronic
1163944944 19:20527306-20527328 ATACAAAAACATGTCCCACCAGG - Intergenic
1164339864 19:24381203-24381225 ATACAAAAACAGTTTCCAAAAGG - Intergenic
1164370762 19:27642094-27642116 ATGGAAAAGCAGCTTACACAGGG - Intergenic
1165405741 19:35629841-35629863 CTAGAATATAAGCTCCCACAGGG - Intronic
1166446151 19:42858488-42858510 ATAAAACAACAGCTCCAGCAGGG - Intronic
1167269968 19:48501109-48501131 AAACTCAAACAGCTCCCACAGGG + Exonic
1167352430 19:48983915-48983937 AGAGAACTACAGCTCCCAGAAGG - Intronic
1167916833 19:52747351-52747373 ATAGAAAAGCAGCTTACACAGGG - Intergenic
1167990888 19:53359594-53359616 ATAGAAAAGCAGCTTACACAGGG + Intergenic
925842195 2:8002968-8002990 AGAGAAAACAAGATCCCACATGG + Intergenic
926473342 2:13289831-13289853 ATAGAAAACCAAATGCCACATGG + Intergenic
928114572 2:28537929-28537951 AAAGAAAATCAGGTCCAACAGGG - Intronic
928281499 2:29950312-29950334 AGAGAGACACAGATCCCACATGG - Intergenic
928858138 2:35824817-35824839 ACAGAAAAATATCTCCCATACGG - Intergenic
929170043 2:38922712-38922734 ATAGAATAATAGCTCTTACAAGG + Intronic
929999119 2:46849176-46849198 ATAGAAAAACACCTCCCCCTTGG - Intronic
931992560 2:67805112-67805134 ATTGAAAAACAGTTTCCACAAGG + Intergenic
932135978 2:69229040-69229062 TTAGAAGAAGAGTTCCCACAGGG - Intronic
932894888 2:75630249-75630271 GTAGGAATGCAGCTCCCACAGGG - Intergenic
934797965 2:97118470-97118492 ATAGAAAAACTTCTTTCACATGG + Exonic
934835457 2:97584969-97584991 ATAGAAAAACTTCTTTCACATGG - Exonic
936132461 2:109858300-109858322 AGAGAAACACAGATGCCACAAGG + Intergenic
936212236 2:110513185-110513207 AGAGAAACACAGATGCCACAAGG - Intergenic
936421376 2:112367752-112367774 AGAGAAACACAGATGCCACAAGG - Intergenic
936655776 2:114485272-114485294 ATAGAATGAGAGCTCCCACTGGG + Intronic
937499059 2:122458146-122458168 ACAGAAAAACAGATGCCACATGG + Intergenic
939436779 2:142187071-142187093 ACAGAAAAACAAATACCACATGG - Intergenic
940750690 2:157624269-157624291 TCAGAATAACAGGTCCCACAGGG + Intronic
944311887 2:198242790-198242812 ATGGAAAATCAGTTGCCACAAGG + Intronic
945336101 2:208594489-208594511 ATATATAAAAAGTTCCCACAAGG - Intronic
945770958 2:214041844-214041866 ATTAAATAACACCTCCCACAAGG - Intronic
947863906 2:233382636-233382658 AATGAAAAACAGCTGCCACGTGG - Intronic
1169523474 20:6398209-6398231 ATAGAAAAGCACCACTCACACGG - Intergenic
1170121829 20:12920650-12920672 ATGGTAAAACATATCCCACAGGG - Intergenic
1170136247 20:13076756-13076778 ATAGAAAGATAGGTCCCACCGGG + Intronic
1172995705 20:39069155-39069177 AAGGAAAATCAGATCCCACAGGG - Intergenic
1174424481 20:50422515-50422537 CTATAAATACAGCTCCCAGATGG + Intergenic
1174628827 20:51938679-51938701 ATAGAAAAACAGCTCTGAACAGG - Intergenic
1177248651 21:18564488-18564510 ATAGAAAAGCAGCTTACACAAGG - Intergenic
1178046780 21:28703679-28703701 ATACAGTAACAGCTACCACAGGG - Intergenic
1178502963 21:33140813-33140835 AAATAAAAGCAGCCCCCACAGGG - Intergenic
1178999722 21:37445577-37445599 ATAGAAAAAAAGCACTCCCATGG - Intronic
1180198813 21:46212851-46212873 AGAGACCAACAGCACCCACAGGG + Intronic
1180838318 22:18943968-18943990 ATGGAAAAGCAGCTTACACAGGG + Intergenic
1184998967 22:48230592-48230614 ATAGAGAAACAGGTGCCAGAGGG + Intergenic
1185143677 22:49117700-49117722 ATGGAAAAACAGCTGCCTGATGG + Intergenic
949409747 3:3750528-3750550 ATCGAGAATCAGTTCCCACAAGG - Intronic
952175675 3:30859961-30859983 AGAAAAAAAGAGCTCACACAGGG - Intronic
953216973 3:40927966-40927988 ATTGAAAAACAGAACCCATAAGG - Intergenic
954840115 3:53504034-53504056 ACAAAAAACCAGCTCCCTCATGG - Intronic
954910201 3:54099153-54099175 ATAGAAAAATAAGTCCCACAAGG - Intergenic
957233315 3:77549870-77549892 ATGGAGAAACAGATCCCAGAGGG + Intronic
957288764 3:78249911-78249933 AAAGAACAAGAGCTCCCACTGGG + Intergenic
957848181 3:85766962-85766984 ATAGATTAGCAGCTCCCACAGGG + Intronic
958964478 3:100543670-100543692 AAAGAAAAACTGCTCCCCCAAGG - Intronic
959316514 3:104814680-104814702 ATAGAAAAACAAATACCACATGG + Intergenic
959925007 3:111911129-111911151 AGAGAAAAATTCCTCCCACATGG - Intronic
960027754 3:113028127-113028149 ATGGAAAAGCAGCTTACACAGGG - Intergenic
961294189 3:125870967-125870989 ATGGAAAAACAGCTCTCTCTGGG - Intergenic
961297261 3:125895589-125895611 ATGGAAAAGCAGCTTACACAAGG + Intergenic
961629548 3:128285980-128286002 ATATAAGTACATCTCCCACATGG + Intronic
961745833 3:129062954-129062976 ATGGAAAACAAGCTCCTACAGGG + Intergenic
961891781 3:130136504-130136526 ATGGAAAAACAGCTCCCTCTGGG + Intergenic
963062677 3:141237592-141237614 TTAGAAAAGCACCTACCACATGG + Intronic
963263765 3:143218703-143218725 ATACAACAACATCACCCACAGGG + Intergenic
964032482 3:152153404-152153426 TTAAAGAAAAAGCTCCCACAGGG - Intergenic
965658893 3:171020104-171020126 AGAGAAAAACTGCTCCTATAAGG - Intronic
966643145 3:182212789-182212811 TTAGGAAATCAGCTGCCACATGG - Intergenic
967026186 3:185566410-185566432 ATGGAAAAGCAGCTTACACAGGG - Intergenic
967429665 3:189367428-189367450 AAAAATAAACACCTCCCACATGG + Intergenic
968396786 4:246455-246477 ATAGAAAAAAATGTACCACAGGG - Intergenic
968861565 4:3175596-3175618 AGAGCCACACAGCTCCCACATGG - Intronic
969003168 4:3998940-3998962 ATGGAAAAACAGCTCTCTCTGGG + Intergenic
969810759 4:9645876-9645898 ATGGAAAAACAGCTCTCTCTGGG - Intergenic
970088908 4:12380811-12380833 AAAAAAAAACATCTCCCACCAGG + Intergenic
970914166 4:21313017-21313039 AAAGCAAAACAGCAGCCACATGG + Intronic
971110387 4:23578602-23578624 AAAGAAAAGCACCTCCCAAAGGG + Intergenic
971731270 4:30384834-30384856 ATAGAGAATCAGATTCCACAAGG - Intergenic
973268449 4:48234998-48235020 ATAGAATGAGAGCTCCCACTGGG + Intronic
974070514 4:57119217-57119239 ATAGCAAGACAACTCCCAGAAGG - Intergenic
974278276 4:59756194-59756216 ATAGATAAACTGTTCCCAAAAGG - Intergenic
974909999 4:68106254-68106276 ATAGAAAGAGATCTCCCAAAGGG - Intronic
976387085 4:84473284-84473306 AGAGAAAAACAGCACCAAAAAGG + Intergenic
976747313 4:88416295-88416317 ATAGCAAAACCGCTCTCACAGGG - Intronic
976914953 4:90360592-90360614 AAAAAAAAAAAGCTTCCACATGG + Intronic
978473379 4:109096934-109096956 ATAGAATGAGAGCTCCCACTGGG + Intronic
978847861 4:113295564-113295586 AAAGAAAAAAAGCTCACAGAGGG - Intronic
980137860 4:128877379-128877401 ATATAAAAATAGTTCACACATGG + Intronic
981101447 4:140833700-140833722 AGAGAAAAACAGCTTGCATAAGG + Intergenic
981527959 4:145725616-145725638 ATACTAAAACAGCTACAACATGG + Intronic
981811894 4:148784798-148784820 ATAGAAAAACAAATCTTACATGG - Intergenic
982216955 4:153090886-153090908 ACAGGAAACCAGCTCCCCCATGG + Intergenic
982954562 4:161747014-161747036 ATGGAAAAAGACCACCCACAGGG - Intronic
983004738 4:162469985-162470007 AGAGGAAAACAGATGCCACATGG - Intergenic
984171988 4:176369948-176369970 ATAGAGAAACAGCTCTATCATGG + Intergenic
985506710 5:285654-285676 CTAGAACATCAGCTCCCACCCGG - Intronic
985506775 5:285992-286014 CTAGAACAACAGCTCCCACCTGG - Intronic
986141168 5:5031800-5031822 TTATAAAATCACCTCCCACAAGG - Intergenic
987671265 5:21012846-21012868 TCAGAAAAACAGCTCCGACATGG - Intergenic
988098396 5:26646672-26646694 AGAAAAAAACATCTTCCACATGG - Intergenic
988359741 5:30220431-30220453 ATAGAATGAGAGCTCCCACTCGG - Intergenic
988380335 5:30490795-30490817 ATGGAAAAGCAGCTTACACAGGG - Intergenic
988630489 5:32925763-32925785 ATAAACAAGCAGCTCCCACTTGG - Intergenic
988848966 5:35159633-35159655 CTATAAAAACAGCTGCCTCAAGG - Intronic
989149001 5:38279616-38279638 ACAGAAAAACAAATACCACATGG + Intronic
989329871 5:40244270-40244292 AAATAAAAATAGCACCCACATGG + Intergenic
989440523 5:41466798-41466820 ATAGAAAGACAAATACCACATGG - Intronic
989921419 5:49809271-49809293 ATCGAAAAACAGTTTCAACACGG - Intergenic
989925601 5:49870933-49870955 ATCGAAAAACAGTTTCAACACGG - Intergenic
989927543 5:49899720-49899742 ATCGAAAAACAGTTTCAACACGG - Intergenic
993182771 5:84575876-84575898 ACAGAAACACAGATACCACATGG - Intergenic
995588618 5:113674849-113674871 ATGGAAAAACAGCCCCAACTGGG - Intergenic
998146657 5:139733143-139733165 AAATAAAAACAGCTACCACTTGG + Intergenic
998707307 5:144778003-144778025 ATATAGAAACAGCTCCTATATGG - Intergenic
999235335 5:150087481-150087503 ATAGTCAAACAGCTACCAAATGG + Intronic
999952031 5:156661568-156661590 ATGGAAAAGCAGCTTACACAGGG - Intronic
1000016172 5:157279013-157279035 ATAGAATGAAAGCTCCCACTGGG - Intronic
1000385242 5:160669144-160669166 ATTGGAAATCAACTCCCACAAGG + Intronic
1001614172 5:173029095-173029117 ATAGAAAAACAGCTCCCACAGGG - Intronic
1002671943 5:180874545-180874567 ATAGAAGGAGAGCTCCCACTGGG - Intergenic
1002760574 6:198697-198719 ATAGAAAAATAGATGCAACAGGG + Intergenic
1002921228 6:1574867-1574889 CTAGAAAGGCAGTTCCCACAGGG + Intergenic
1006326423 6:33357229-33357251 ATAAAATAAAAACTCCCACAAGG + Intergenic
1006943258 6:37766761-37766783 ATAGAATGAGAGCTCCCACTGGG + Intergenic
1009441867 6:63689274-63689296 GTAGAAAAACAGAAACCACAAGG - Intronic
1009498039 6:64374521-64374543 CTAGGAAAACATCTCCAACATGG - Intronic
1010024884 6:71203709-71203731 ATAGAATGAAAGCTGCCACAAGG + Intergenic
1010591809 6:77721062-77721084 ATGGAAAAGCAGCTTACACAGGG - Intronic
1013880823 6:114898260-114898282 ATAAAAAATAACCTCCCACAAGG + Intergenic
1014298641 6:119652367-119652389 AGGGAAAAAGAGCTCCCATAGGG + Intergenic
1015386161 6:132626385-132626407 ATATTAAAACATCTCCCACAAGG - Intergenic
1015536672 6:134273723-134273745 ATAGAAAACAAGCTCCAAAAAGG + Intronic
1016509225 6:144821368-144821390 ATAGTAAAACACCCCCCATAAGG - Intronic
1017043358 6:150325191-150325213 ACAGAACACCAGCACCCACATGG - Intergenic
1017213294 6:151880563-151880585 ATAGGAAAACAGCCTCCAAAAGG + Intronic
1017739722 6:157396088-157396110 ATAGAAACACAACTCTCATAGGG + Intronic
1020359320 7:7310452-7310474 ATACAAAAAAAGCTCTCAAAAGG - Intergenic
1021196151 7:17676442-17676464 AGAGAAAAACAGCTCTCTAAAGG + Intergenic
1022064965 7:26845103-26845125 ACAGAAAAACAGCCACCTCAGGG + Intronic
1022967274 7:35485547-35485569 TCACAAAAACTGCTCCCACAAGG - Intergenic
1022967424 7:35486718-35486740 TCACAAAAACTGCTCCCACAAGG - Intergenic
1024116465 7:46198369-46198391 ATAGAAAACAACCTCACACATGG + Intergenic
1024197356 7:47072389-47072411 ACAGGAAAAGGGCTCCCACAGGG + Intergenic
1027343259 7:77232485-77232507 ATAGAAAAACAGATATCATAAGG - Intronic
1027464352 7:78496482-78496504 ATAAAAGAAGAGCTGCCACAGGG - Intronic
1028310818 7:89333406-89333428 ATAGAAAAGCAACTCCAGCAAGG + Exonic
1029784266 7:102771108-102771130 ATAGAAAACCAAATACCACATGG + Intronic
1030088175 7:105835104-105835126 AAAAAAAAACAGCTTCCACAGGG - Intronic
1030115852 7:106061825-106061847 ATAGGACAGCACCTCCCACAGGG - Intergenic
1033975877 7:147099929-147099951 AAATAAAAACAGCTTCCACATGG + Intronic
1035133011 7:156673553-156673575 ATAGAAAAGCAGCTTCCACCAGG + Intronic
1035347393 7:158212185-158212207 GTAGAACAACAGCTACCAGAAGG + Intronic
1036292034 8:7502029-7502051 ATGGAAAAGCAGCTTACACAGGG - Intronic
1036374062 8:8184984-8185006 ATGGAAAAACAACTCCCTCTGGG - Intergenic
1036404797 8:8445236-8445258 GTAGAATAACAGTTCCCACAAGG + Intergenic
1036876842 8:12480655-12480677 ATGGAAAAACAACTCCCTCTGGG + Intergenic
1037333333 8:17766481-17766503 AAAGAAAAATAACTCCCAAATGG - Intronic
1037599232 8:20379940-20379962 AGAGAACAAAAGATCCCACATGG + Intergenic
1038409748 8:27348895-27348917 ATAGAAGAACAGCCTCCAAATGG - Intronic
1041232525 8:55768206-55768228 ATACAAAAACAGCTCTTACCAGG - Intronic
1041724656 8:61006705-61006727 ACAGAAAAACATCACTCACAAGG + Intergenic
1042939053 8:74089203-74089225 AAAGATAAACAGTTCTCACAGGG - Intergenic
1046333153 8:112748390-112748412 ATAGATAAACAGGTGTCACAGGG + Intronic
1049671400 8:143871706-143871728 AGAGAAGAGCAGCTCCCAGAGGG + Exonic
1049913809 9:296927-296949 ATGGAAAATCAGAACCCACATGG - Intronic
1050350806 9:4740100-4740122 ATAGAAATAATGCTTCCACAAGG - Intronic
1052223581 9:26056943-26056965 ATAAAAATAAAGCTTCCACATGG - Intergenic
1055488052 9:76776379-76776401 ATGGAAAATCAGATACCACATGG - Intronic
1056192387 9:84196902-84196924 ATACAAAAACAGATTCCTCACGG - Intergenic
1056958619 9:91102316-91102338 ACAGTAAAACAGCTGCCCCATGG + Intergenic
1058270152 9:102962180-102962202 ACAGAAAAACAAATACCACATGG - Intergenic
1058475435 9:105328200-105328222 GTAGAATATCAGCTCCAACAGGG - Intronic
1058969715 9:110069700-110069722 AGGGAACAACAGCTTCCACATGG + Intronic
1059000722 9:110345723-110345745 ATACACAAACAGATCGCACATGG + Intergenic
1062482674 9:136759659-136759681 ATAGAAAGAGACGTCCCACAAGG + Exonic
1185892195 X:3831716-3831738 ATAGCAAAACACCTACCAAAGGG + Intronic
1185897302 X:3870135-3870157 ATAGCAAAACACCTACCAAAGGG + Intergenic
1185902421 X:3908567-3908589 ATAGCAAAACACCTACCAAAGGG + Intergenic
1188668135 X:32850362-32850384 ATAGATGAAAAGCTCTCACAGGG - Intronic
1189019217 X:37317257-37317279 ATTGAAAGACTGCTCCCTCAGGG + Intergenic
1189198812 X:39174441-39174463 AAAGTAAAACAGCTTCCACCTGG - Intergenic
1189714286 X:43849174-43849196 ATAGAATAGCAGCTGGCACACGG - Intronic
1191157019 X:57284805-57284827 GTAGAATAACAGCTGCCATATGG - Intergenic
1194872222 X:99146575-99146597 ATAGAAAAAGAGGTCACACTGGG + Intergenic
1196042110 X:111215821-111215843 ATAGGGATACAGCTGCCACAGGG + Intronic
1196406285 X:115365984-115366006 AGACATAAACAGCTCCCAAAAGG + Intergenic
1199072092 X:143489173-143489195 TTAAAAAAACATCTCCCAAAAGG - Intergenic
1201642137 Y:16191374-16191396 ATAGGAAAAAAGATCCCACAGGG + Intergenic
1201660678 Y:16393947-16393969 ATAGGAAAAAAGATCCCACAGGG - Intergenic
1201787152 Y:17797293-17797315 ATACAAAAACACATCACACATGG + Intergenic
1201814401 Y:18108695-18108717 ATACAAAAACACATCACACATGG - Intergenic
1202266954 Y:23029565-23029587 ATAGGAATACAGGTCACACAAGG + Intergenic
1202419947 Y:24663310-24663332 ATAGGAATACAGGTCACACAAGG + Intergenic
1202450839 Y:25006774-25006796 ATAGGAATACAGGTCACACAAGG - Intergenic