ID: 1001617977

View in Genome Browser
Species Human (GRCh38)
Location 5:173057291-173057313
Sequence GCAGCCATGTTAGATGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001617961_1001617977 18 Left 1001617961 5:173057250-173057272 CCACTAATTGGTTAGGCTGTGCC 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1001617977 5:173057291-173057313 GCAGCCATGTTAGATGGGAGGGG 0: 1
1: 0
2: 1
3: 14
4: 209
1001617959_1001617977 29 Left 1001617959 5:173057239-173057261 CCGCGGGGGGGCCACTAATTGGT 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1001617977 5:173057291-173057313 GCAGCCATGTTAGATGGGAGGGG 0: 1
1: 0
2: 1
3: 14
4: 209
1001617971_1001617977 -3 Left 1001617971 5:173057271-173057293 CCGGAGGTGGGCCGGGCGGGGCA 0: 1
1: 1
2: 1
3: 28
4: 324
Right 1001617977 5:173057291-173057313 GCAGCCATGTTAGATGGGAGGGG 0: 1
1: 0
2: 1
3: 14
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001617977 Original CRISPR GCAGCCATGTTAGATGGGAG GGG Intronic
901909034 1:12439431-12439453 GCTGCAATTTTAGATGGGGGAGG - Intronic
903192758 1:21666124-21666146 GCAGACATGCTAGATGGGGAGGG - Intronic
904942298 1:34172809-34172831 GCAGCCATGTTTCATGGGAATGG - Intronic
905457471 1:38098044-38098066 CCCGCCTTGTTACATGGGAGAGG + Intergenic
906725226 1:48039726-48039748 GCAGCAATCTCAGAAGGGAGTGG - Intergenic
907245251 1:53104144-53104166 GCAGTGATGTTTGAGGGGAGAGG - Intronic
907864088 1:58382104-58382126 GCAGGCAAGTTAAATGGGGGAGG + Intronic
909153877 1:72045098-72045120 GCAGCTATGTTATGTGGGTGAGG - Intronic
911292178 1:96070917-96070939 CCAGCCATGATAGATGGGAGTGG + Intergenic
914675874 1:149906883-149906905 GCAGTCATAGCAGATGGGAGAGG + Intronic
915098961 1:153484842-153484864 GCAGCTCTCTGAGATGGGAGTGG - Intergenic
915592568 1:156879026-156879048 GCAGCCGCGTGTGATGGGAGAGG - Intronic
916262613 1:162857490-162857512 GCAGGCATGTGACATGGAAGTGG - Intronic
917637801 1:176954094-176954116 GCAGCCATGGGAGATGGCAGTGG - Intronic
917646581 1:177034544-177034566 GCTGCCAGGATGGATGGGAGTGG - Intronic
918127951 1:181600702-181600724 GGAGGCATGTTAAATTGGAGTGG + Intronic
919548903 1:198959934-198959956 GCTGCCATCTTATATGGGTGTGG + Intergenic
919993515 1:202726577-202726599 GCAGCTTTGTGAGGTGGGAGAGG - Exonic
920096110 1:203487626-203487648 GCAGCCATGGGAGAGGGGAAGGG + Exonic
920100225 1:203512750-203512772 GCAGCCATGCAAAATGTGAGGGG + Intergenic
920452958 1:206074028-206074050 CCAGCCAAGATAGAGGGGAGCGG - Intronic
920831262 1:209467651-209467673 GAAGCTATCTAAGATGGGAGTGG + Intergenic
922336460 1:224622530-224622552 GCAGTCATGTTAGAGAGGAGAGG + Intronic
922345957 1:224696536-224696558 GCAGGAATGTGAGGTGGGAGAGG + Intronic
922446883 1:225705386-225705408 GAAGGCATCTTAGATGGTAGAGG + Intergenic
923981211 1:239326288-239326310 ACAACCAAGTTAGAGGGGAGTGG + Intergenic
1063806846 10:9654385-9654407 GCAGCAATTGTAGATGGGATGGG + Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1067762307 10:49057580-49057602 GCAGGCCTGTGAGATGGGGGTGG - Intronic
1067879971 10:50034772-50034794 ACTGCCATGTGAGAGGGGAGAGG + Intergenic
1067891912 10:50144608-50144630 ACTGCCATGTGAGAGGGGAGAGG - Intergenic
1068455942 10:57254080-57254102 GTAGTCATCTTAGCTGGGAGAGG - Intergenic
1070784706 10:79156227-79156249 GCAGGGATGTTAGGTGGGTGGGG + Intronic
1073319621 10:102606931-102606953 GCAGCCAACTCAGGTGGGAGCGG + Intronic
1075089779 10:119437171-119437193 GCAGCCAGGGAAGCTGGGAGGGG + Intronic
1077324829 11:1959210-1959232 GCAGGCATGTGAGGTGGGTGTGG - Intronic
1078103071 11:8341258-8341280 GCAGCCTTGTTAGATACAAGGGG - Intergenic
1080709612 11:34734330-34734352 GCAGCCCTGGGACATGGGAGAGG - Intergenic
1082783418 11:57303479-57303501 GCGGCCATGGTGGCTGGGAGGGG - Intronic
1202807809 11_KI270721v1_random:14387-14409 GCAGGCATGTGAGGTGGGTGTGG - Intergenic
1092020975 12:5201971-5201993 GCAGCCATATTAGAGTGAAGAGG - Intergenic
1095378170 12:41556842-41556864 GCAGCCATTCTTTATGGGAGAGG - Intronic
1096297562 12:50396736-50396758 GCTGCCATGGTAGAAGGGTGAGG + Intronic
1098489927 12:71063741-71063763 GCAGTCATGTTAGAGCAGAGAGG + Intronic
1100043652 12:90352156-90352178 GTAGCTATGATAGATGGGAAGGG + Intergenic
1100327212 12:93550965-93550987 TCTGCCATGTGAGATGGGAAGGG - Intergenic
1102922991 12:116806969-116806991 GAAGCCATGTAAAAAGGGAGAGG - Intronic
1102995359 12:117345968-117345990 GCAGCCCTGTGAGAGGTGAGAGG + Intronic
1104619568 12:130301227-130301249 GCTGCCATTCTAGATGGGGGGGG + Intergenic
1106052973 13:26208697-26208719 GCAACCATGTAACTTGGGAGGGG - Intronic
1106179760 13:27360648-27360670 GCATGCATGGTAGCTGGGAGAGG - Intergenic
1107350317 13:39507433-39507455 GCAGTCCTTTGAGATGGGAGGGG - Intronic
1108698610 13:52924960-52924982 GCTGCAATGTTAGCTGGGTGCGG - Intergenic
1109825729 13:67718802-67718824 GCAGACTTGAAAGATGGGAGTGG + Intergenic
1111916260 13:94363784-94363806 GCTGCCATGTTAGATGGCACAGG - Intronic
1112225449 13:97535320-97535342 GGAGCCATGGTTGATAGGAGAGG - Intergenic
1113639851 13:111949488-111949510 CCAGCCATGCTGCATGGGAGTGG + Intergenic
1113929601 13:113959551-113959573 GGAGCCCTTCTAGATGGGAGGGG + Intergenic
1115318990 14:32057954-32057976 GCAGACAGGTTAGGTAGGAGAGG - Intergenic
1115972782 14:38964472-38964494 GGAGCCCTGTGAGATGGCAGTGG - Intergenic
1116105881 14:40504625-40504647 GCAGACAGGTTAGATGGATGAGG + Intergenic
1116649010 14:47565916-47565938 GCAGCAATGGTAGTTTGGAGTGG + Intronic
1117580135 14:57143614-57143636 GCTGCCATGGTAGGTGGTAGAGG - Intergenic
1117997743 14:61493760-61493782 GCAGCCAGGTTGCAAGGGAGAGG + Intronic
1119350563 14:73961398-73961420 GCAGCAAAGTGAGAAGGGAGTGG - Intronic
1119512229 14:75220541-75220563 GCAGCCGTGCGAGATGGAAGTGG + Intergenic
1122338209 14:101007515-101007537 GAAGCCATATTGGAGGGGAGGGG + Intergenic
1123774926 15:23569514-23569536 GGAGTCATGTAAGAAGGGAGAGG - Intronic
1124555693 15:30723733-30723755 GCACCCATGCTAGACTGGAGTGG - Intronic
1124675575 15:31681986-31682008 GCACCCATGCTAGACTGGAGTGG + Intronic
1125239578 15:37558453-37558475 GCACCCATGTCTGATGGGGGAGG - Intergenic
1125279504 15:38028744-38028766 GCAGCAATGGTAGAAGGTAGTGG + Intergenic
1125775141 15:42206006-42206028 ACAGGCATGTTTGAGGGGAGAGG + Intronic
1126197357 15:45947240-45947262 GCAGCCATCTTTGCTGGGACAGG - Intergenic
1126277452 15:46900937-46900959 GCAGTCATGTTAGAGGTTAGTGG - Intergenic
1127294245 15:57595902-57595924 GCAGCAATGGGACATGGGAGAGG - Intronic
1127469308 15:59276168-59276190 GCTGCCATGTGTGCTGGGAGAGG + Intronic
1127596766 15:60491618-60491640 GTAGCCATCCTAGATGGGCGGGG - Intronic
1130293419 15:82624687-82624709 GGACCCATGATTGATGGGAGAGG - Intronic
1130920371 15:88338875-88338897 CCAGGAATGTTAGGTGGGAGAGG + Intergenic
1131080371 15:89529440-89529462 GCAGCCATGCTAGGTAGAAGGGG - Intergenic
1131376161 15:91925507-91925529 GCAACCACCTAAGATGGGAGAGG - Intronic
1132058353 15:98669697-98669719 GCAGCCTTGTCAGGTGGGTGTGG + Intronic
1132883768 16:2173540-2173562 GCATCCATGTTAAATGTGAGCGG + Exonic
1137377143 16:47961941-47961963 GAGGCCAAGTCAGATGGGAGGGG - Intergenic
1137488622 16:48912368-48912390 ACTGTCATGTTAGATGGGGGTGG - Intergenic
1138030762 16:53557869-53557891 GCAGCCTTGGTAGATTGGAATGG + Intergenic
1139588398 16:67919071-67919093 GCAGCCATGTGAGCAGGGATAGG + Intronic
1141405961 16:83793349-83793371 TCAGCAATGTTGGCTGGGAGAGG - Intronic
1142568063 17:853406-853428 TCAGCCAGGTTAGAAGGCAGTGG - Intronic
1142604469 17:1073912-1073934 GAAGCCATGTCTGATGGGAGAGG - Intronic
1142683683 17:1564419-1564441 GCATCCAGGGGAGATGGGAGTGG + Intergenic
1143891427 17:10105441-10105463 GCTACCATGTTAGATGGTACAGG + Intronic
1144180379 17:12746043-12746065 TCATCCAGGTTAGGTGGGAGTGG - Exonic
1145199675 17:20932073-20932095 GCAGCCAAGTAAGATGTGATTGG - Intergenic
1147141422 17:38462813-38462835 TCAGCCAGGTTAGCTGGGGGTGG - Intronic
1152063231 17:78094943-78094965 GGAGCCGTGTAAGATGGCAGAGG + Intronic
1152111674 17:78360410-78360432 TCAGCCTTCTTAGAAGGGAGGGG - Intergenic
1153726162 18:7957623-7957645 GAAGGCATGTTAGGTGGGTGAGG + Intronic
1156226947 18:35118804-35118826 GCAGCCAGGTCAGGTGGGTGAGG - Intronic
1157296499 18:46448601-46448623 CCAGCCCTGTGAGATGGGCGAGG - Intronic
1157430401 18:47619834-47619856 GGAGCTATGGTAGATGGGACAGG + Intergenic
1157528032 18:48399995-48400017 GCAGCCATAAAAGAGGGGAGGGG - Intronic
1157685809 18:49641346-49641368 GCAGCTATGTTTGAAGTGAGAGG + Intergenic
1158877707 18:61749000-61749022 GTAGCCATGTCAGGTGGCAGGGG - Intergenic
1161589260 19:5121550-5121572 GGAGCCATGTTTGCTGCGAGCGG - Intronic
1162302566 19:9852224-9852246 GCAGCCAGGCTAGTTGGAAGGGG - Intergenic
1163151465 19:15417638-15417660 GCAGCCAGGGTAGAGGGGACTGG + Intronic
1164966400 19:32488704-32488726 GCAGCCTTGTGAGACAGGAGAGG - Intergenic
1166213831 19:41323430-41323452 GCAGCCAGGTTTGAGGGAAGGGG - Exonic
1166608635 19:44168051-44168073 GTGGTCATGTTAGATGGAAGAGG + Intronic
926312276 2:11683436-11683458 CCAGACATGGGAGATGGGAGCGG + Intronic
927279494 2:21291500-21291522 GCAGGCATTTCAGCTGGGAGAGG - Intergenic
928940066 2:36718483-36718505 GCAGCCATGTTACATAGGGTTGG - Intronic
929508355 2:42546465-42546487 GTTGCCAGGTTAGATGGCAGGGG - Intronic
930517598 2:52428212-52428234 GCACCCATGTGAGAGGGAAGTGG - Intergenic
931679293 2:64730243-64730265 CCACACATTTTAGATGGGAGAGG + Intronic
932434708 2:71696236-71696258 TGAGCCTTTTTAGATGGGAGAGG + Intergenic
933294163 2:80470946-80470968 GCAGCCATGCAAGACTGGAGTGG + Intronic
935172755 2:100623460-100623482 GCATTCATGTTCCATGGGAGAGG + Intergenic
936257895 2:110933454-110933476 GCAGACATGTGTGATGGAAGTGG - Intronic
937092211 2:119213946-119213968 GCTGCCATGTTAGGTGGGCCTGG + Intergenic
937869699 2:126778305-126778327 GCAGCCACATGAGTTGGGAGGGG - Intergenic
940130509 2:150376189-150376211 GTAGCCATCTTTGATGGAAGGGG - Intergenic
940498928 2:154470141-154470163 GAAAACATGTTAGATGGTAGAGG - Intergenic
940990778 2:160094132-160094154 GCAGACATCTTACATGGCAGGGG - Intergenic
945825116 2:214712151-214712173 GCAGCCAGTCCAGATGGGAGTGG + Intergenic
946015217 2:216598887-216598909 TCAGCCATGGGGGATGGGAGAGG - Intergenic
946907076 2:224427850-224427872 GAAGCTAAGTTAGATGGAAGTGG - Intergenic
948044943 2:234936373-234936395 TCAGCCATGTCAGATGTGAGTGG - Intergenic
1171116933 20:22532958-22532980 GCTGCCATGTTAGAGAAGAGAGG - Intergenic
1172701551 20:36856380-36856402 GCACCCTTTATAGATGGGAGTGG + Intronic
1172936520 20:38624411-38624433 GCAGCTATGTTCAAGGGGAGGGG + Intronic
1173984016 20:47247098-47247120 GCAGACATGTTTCATGCGAGAGG + Intronic
1175187179 20:57186647-57186669 GCCCCCAAGTTAGATGGGAGGGG + Intronic
1176125758 20:63473739-63473761 GCAGCCATGTGTCCTGGGAGGGG + Intergenic
1177409450 21:20710711-20710733 GCAGTCATGTTTGATGGAATGGG - Intergenic
1180902521 22:19385148-19385170 GAAGCCATGTTTGATGGGAAGGG - Intronic
1181109848 22:20595649-20595671 GCAGCAATGTTATAAGGGATGGG + Intergenic
1182294690 22:29306249-29306271 GCAGCCATGCTACACGGGTGGGG - Intergenic
1182771119 22:32797015-32797037 GTGGCCATGGCAGATGGGAGGGG + Intronic
1185244560 22:49766088-49766110 TCAGCCAAGTCAGATGGGAGCGG + Intergenic
949511806 3:4772859-4772881 AAAGCCATGAGAGATGGGAGAGG + Intronic
950007329 3:9699744-9699766 GCAGCCATGTCAGGGGGGTGGGG + Intronic
950280273 3:11701281-11701303 GCAGGCATGTCACATGTGAGAGG - Intronic
950489438 3:13294707-13294729 GCACCCCTGTTTGTTGGGAGGGG - Intergenic
951051233 3:18096468-18096490 GCAGCCCTGCCAGATGGGCGCGG - Intronic
952049324 3:29363748-29363770 GCACCCATGCTAGAGGGCAGTGG - Intronic
953444467 3:42950890-42950912 CCAGCCATGTTTGTTGGGAATGG + Intronic
953557076 3:43954451-43954473 GCAGCAATGTTACAAGGGAGGGG + Intergenic
954452519 3:50579452-50579474 GCAGTCATGTTGGATGGGGCTGG + Intronic
954489717 3:50891975-50891997 GCAGCCATATTTGCTGGAAGTGG + Intronic
956114703 3:65906593-65906615 ACAGCCATCTTAGCTGGGTGTGG + Intronic
957208820 3:77234247-77234269 GCAGGCGTGGGAGATGGGAGGGG - Intronic
957759860 3:84540580-84540602 GCAGCCAAGGTAAATGGGACAGG + Intergenic
961525823 3:127496733-127496755 GCAGCCATGGTCGGTGGGGGCGG - Intergenic
961661587 3:128471548-128471570 GGAGCCTTGTAACATGGGAGTGG + Intergenic
962663412 3:137628214-137628236 ACAGCCCTGTTAGTTTGGAGTGG + Intergenic
963125928 3:141816295-141816317 GCTGCCTTTTTAAATGGGAGTGG + Intronic
967341470 3:188403645-188403667 TCAGCCATGTGAGATGGGTTTGG + Intronic
969154978 4:5202363-5202385 GCAGCCATGATATTTGGGTGGGG - Intronic
971623417 4:28886733-28886755 GCATCCATGTTAGTTGAGTGAGG - Intergenic
975397479 4:73893705-73893727 GCAGCCATATTCTATTGGAGCGG + Intergenic
976242342 4:82971408-82971430 GCCGCCATCTCAGATGGCAGAGG - Intronic
976555264 4:86443484-86443506 GCACCCATCTTAGGTGGGACAGG - Intronic
977136086 4:93306418-93306440 GCAGAGATGTGACATGGGAGAGG + Intronic
980718605 4:136661806-136661828 GAAGCCATTTCAGATGGAAGGGG - Intergenic
980800131 4:137736077-137736099 ACTGCCAGGGTAGATGGGAGAGG + Intergenic
981247143 4:142553898-142553920 ACAGCCAGGTTGGCTGGGAGCGG + Intronic
981919865 4:150076015-150076037 GCAGCCCTGTTTGATGTGGGAGG - Intergenic
982030781 4:151298543-151298565 GCAGACATTTTAGATTTGAGAGG + Intronic
983774288 4:171586940-171586962 GCTTCCATGTTAGAAGGGCGAGG - Intergenic
984035720 4:174665063-174665085 GAGGCTATGTTAGATGGCAGTGG + Intronic
984911673 4:184679601-184679623 TCATCCATGTTAGAAGGTAGTGG + Intronic
985180402 4:187255296-187255318 GCAGCCATCTTAGATAAGTGTGG - Intergenic
988461701 5:31444641-31444663 GCAGCCATGTTAGAGGGCTATGG + Intronic
989474347 5:41857196-41857218 GCTGCCATGTTGTGTGGGAGGGG - Intronic
989837317 5:46008916-46008938 GCACCCATGTTGGATGCCAGAGG + Intergenic
990501583 5:56401740-56401762 ACAGCCATGGTTGATGGGGGCGG + Intergenic
990997445 5:61746541-61746563 TCACTCATGTTAGACGGGAGAGG + Intronic
991665808 5:68998836-68998858 GCAACCAGGCTAGATGGGGGTGG + Intergenic
992269473 5:75051163-75051185 GCAGCCATGGGGGAGGGGAGAGG - Intergenic
995604044 5:113832066-113832088 ACAGCCATGTTACAAGGGATTGG + Intergenic
996762445 5:127000168-127000190 GGAGCCATGCTAAAAGGGAGGGG - Intronic
998138051 5:139684810-139684832 GCAGCCATGTTGGGTGGGGGTGG + Intergenic
999664342 5:153897113-153897135 GCACCCATGTTCAAGGGGAGGGG + Intergenic
1001617977 5:173057291-173057313 GCAGCCATGTTAGATGGGAGGGG + Intronic
1003439597 6:6126999-6127021 GGAGCCATGCTAGGTGGGGGAGG - Intergenic
1003951780 6:11122916-11122938 ACACCCATGTCAGCTGGGAGTGG + Intronic
1004067064 6:12257807-12257829 GCAGCCTTTTTACATGTGAGAGG - Intergenic
1004558161 6:16720159-16720181 CCAGCCCTGGAAGATGGGAGTGG - Intronic
1004893909 6:20128085-20128107 GCAGCCATGGTGGAGGGGCGGGG - Intronic
1007416652 6:41694924-41694946 GCAGCCATGTGATTGGGGAGAGG - Intronic
1007913671 6:45540495-45540517 GCAGGCATGGTAGATCTGAGCGG - Intronic
1010516975 6:76785256-76785278 GCAGCCATGTCAGCTGGTTGTGG - Intergenic
1013763137 6:113541594-113541616 GCAGCCAGTTTAGATTAGAGAGG - Intergenic
1014946474 6:127504542-127504564 GTGGCCATGGTAGAGGGGAGTGG + Intronic
1015041220 6:128722033-128722055 TCAGTCATGCTTGATGGGAGTGG + Intergenic
1017568028 6:155709600-155709622 CAAGCCCTGTTAGCTGGGAGGGG - Intergenic
1018576077 6:165261773-165261795 GCAGGCATGTTGGATAGCAGAGG + Intergenic
1019222850 6:170488086-170488108 GCTGCCATGTTTGATGGTTGGGG + Intergenic
1021240926 7:18200342-18200364 GGAGCCATTTTAGATTTGAGAGG + Intronic
1021832748 7:24633019-24633041 GCAGCAATATTATATGGGACAGG - Intronic
1026448816 7:70509315-70509337 ACAGCCATGGTGTATGGGAGAGG + Intronic
1026511016 7:71027439-71027461 GCAGCCATGGGAACTGGGAGGGG + Intergenic
1032021415 7:128408964-128408986 GCAGCTGGGTTAGATGGGGGTGG - Intronic
1032895833 7:136249886-136249908 GCAGCCATGTTAGCAGAGAGAGG + Intergenic
1033227822 7:139575021-139575043 GCAGCCCTGTGAGGTGGGTGAGG + Intronic
1034057930 7:148055966-148055988 GAAGCCATGTTAGAGGGTACAGG - Intronic
1034918660 7:155061076-155061098 GCTGCCTTGGCAGATGGGAGAGG - Intergenic
1037313961 8:17583370-17583392 CCAGCCAAGTTAGAGGGGTGGGG + Intronic
1046107871 8:109688654-109688676 GCAGACATGATAGACGGGATAGG - Intronic
1051932804 9:22406735-22406757 GCAGCCATGTTAATTGCTAGAGG - Intergenic
1052238320 9:26240490-26240512 GGATCCATGTCAGATAGGAGTGG - Intergenic
1055322620 9:75097318-75097340 GAAGCCCTGTCAGATGGGAAGGG - Intronic
1057926047 9:99150714-99150736 GCACCCTTGTTACTTGGGAGAGG + Exonic
1059349904 9:113657060-113657082 GCATCCAGGTGAGAGGGGAGGGG + Intergenic
1061013927 9:127971229-127971251 GCAGCCCTGTTTGATGGAGGAGG + Intronic
1186023473 X:5283165-5283187 ACAGCCATGCGAGATGGAAGCGG - Intergenic
1188129249 X:26410726-26410748 TCAGCCATGTGACAAGGGAGGGG + Intergenic
1190327665 X:49216539-49216561 GCAAACAGGTTAGATGGGTGAGG + Intronic
1190836298 X:54104133-54104155 GCAGCCCTGCTGAATGGGAGAGG - Intronic
1192043265 X:67645132-67645154 GCAGCCATATCAGATGGGAAAGG + Intronic
1192616796 X:72633263-72633285 GCAGCCATCATGGATGGGATCGG + Intronic
1196981716 X:121221596-121221618 ACTGCCATTTTAGATGGGCGTGG + Intergenic