ID: 1001618113

View in Genome Browser
Species Human (GRCh38)
Location 5:173058150-173058172
Sequence TAGGATATACACCAGAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001618113 Original CRISPR TAGGATATACACCAGAGGCA GGG Intronic
901345821 1:8541213-8541235 TAGGATATAACCCTGAGACAAGG - Exonic
903447977 1:23434544-23434566 GATGAAATCCACCAGAGGCAGGG + Exonic
907609666 1:55855740-55855762 CAGGACATACACCAGAGTAAAGG - Intergenic
908227517 1:62071028-62071050 TAGGAAAGAGACCCGAGGCAGGG + Intronic
909289068 1:73859102-73859124 TAAGATCTCCACCAGAGGCTGGG - Intergenic
913112840 1:115671596-115671618 CAAGATAAACAGCAGAGGCATGG - Intronic
917733185 1:177897050-177897072 TAGGGGAGACACCAGAGGTAAGG - Intergenic
1065613178 10:27492830-27492852 AATGATAGATACCAGAGGCATGG - Intergenic
1066941004 10:41879869-41879891 TGGAATATACACCAGTGGAAAGG + Intergenic
1068611238 10:59062629-59062651 TAGTATATACCCAAGAGGAATGG + Intergenic
1069053661 10:63821253-63821275 AAGGAATTCCACCAGAGGCAAGG + Intergenic
1069960584 10:72076807-72076829 TAGGATCAACACCAGAAGAAAGG + Intronic
1071417723 10:85456733-85456755 TAAAATATACACCAGAGTGAGGG - Intergenic
1073844611 10:107540355-107540377 TTGGATATATACCAAAGGAAGGG - Intergenic
1074373480 10:112919783-112919805 CAGGAAACACACCAGAGCCAAGG + Intergenic
1075282089 10:121147814-121147836 TAGGATCAAGACCAGGGGCAGGG + Intergenic
1075693030 10:124412936-124412958 TAGGGCAGAGACCAGAGGCAGGG + Intronic
1077741078 11:4846380-4846402 TAGGATGTTTACCAGAGGCTGGG + Intronic
1077987828 11:7373066-7373088 TAGGATTTATCCCAGAGGCATGG - Intronic
1078366731 11:10712740-10712762 TAGACTATAAACCTGAGGCAGGG - Intergenic
1081196272 11:40164678-40164700 AATGATAGATACCAGAGGCAGGG + Intronic
1081534130 11:43985071-43985093 TAGCAAATCCACGAGAGGCAGGG + Intergenic
1086644511 11:89203365-89203387 TGGGTCATATACCAGAGGCAGGG - Intronic
1091494712 12:962175-962197 TAGGACATTGACAAGAGGCAGGG + Intronic
1092620234 12:10256469-10256491 TAGAATATACACAAAAGGAAAGG - Intergenic
1093681078 12:22004191-22004213 AAAGATAGATACCAGAGGCAGGG - Intergenic
1093968127 12:25348366-25348388 TAGAAAATACAGCAGAGGGAAGG + Intergenic
1094159692 12:27377462-27377484 CAGGATGTACAGCAGAGGAAGGG - Intronic
1096579957 12:52578598-52578620 TGGGATATGCACCAGAGACATGG + Intergenic
1101274322 12:103182251-103182273 TAAAATATATACCAGAGCCATGG + Intergenic
1102553311 12:113708625-113708647 TATGATAGATACCAGAGGCTGGG + Intergenic
1103227467 12:119300588-119300610 TAGAATTTATACCACAGGCATGG + Intergenic
1103922989 12:124409167-124409189 TAGGATTTACAACAGAGCCTCGG - Intronic
1105386267 13:19932350-19932372 AAGAATAGACACCAGAGGCCGGG + Intergenic
1109109238 13:58294430-58294452 TAGGAGATACACCTAAGGGATGG - Intergenic
1109116113 13:58387958-58387980 TAGAATATACACAATAGGCCGGG - Intergenic
1110461907 13:75754510-75754532 TAGGATATATACCTGGGGGAAGG + Intronic
1112146093 13:96702008-96702030 TAGCATATACAACAGATGTAAGG + Intronic
1114546414 14:23505608-23505630 TAGGAATAATACCAGAGGCAGGG - Intronic
1118101395 14:62607952-62607974 TAGGAAATACAGCACATGCACGG + Intergenic
1118610772 14:67537835-67537857 GGGGATATGCCCCAGAGGCAGGG - Intronic
1118702954 14:68452031-68452053 TAGAAAATGCAGCAGAGGCAAGG - Intronic
1120472239 14:84939972-84939994 TACCAGATGCACCAGAGGCATGG - Intergenic
1121200762 14:92115562-92115584 TAGGATACACACAGGAAGCAAGG - Intergenic
1121684816 14:95827917-95827939 CAGCATATTCTCCAGAGGCAAGG - Intergenic
1121728915 14:96172834-96172856 CAGCAGACACACCAGAGGCATGG + Intergenic
1125345834 15:38717744-38717766 AATGATATATACCCGAGGCATGG + Intergenic
1125977542 15:43968314-43968336 TAGGAAATACTCCATTGGCAAGG - Intronic
1126558976 15:50022724-50022746 TAGGACCTTCACCAGAGGCCAGG - Intronic
1129908182 15:79204569-79204591 TAGGACAAACAGTAGAGGCACGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1135112810 16:19703958-19703980 CAGAATTTACACCAGGGGCAAGG + Exonic
1137889980 16:52149291-52149313 AAGGAAATACACAAGAGGAAAGG - Intergenic
1140184285 16:72752945-72752967 TAGGATAATCTCCAGAGGCCAGG + Intergenic
1143787687 17:9268390-9268412 TAGGAAATACACAAGAGCAAAGG + Intronic
1146299104 17:31674342-31674364 CAGGATAGACACTGGAGGCATGG - Intergenic
1146607854 17:34277150-34277172 AAGAATAGACACCAGAGGCTTGG - Intergenic
1146643884 17:34563549-34563571 ATGGAAATACACAAGAGGCAAGG - Intergenic
1150298212 17:64026309-64026331 TAGGAAAGATGCCAGAGGCAGGG + Intergenic
1151295262 17:73181037-73181059 TAGGATATTTTTCAGAGGCAGGG - Intergenic
1151615123 17:75205172-75205194 TAGAACACACACAAGAGGCACGG - Intergenic
1158789444 18:60759537-60759559 TATTCTATACACTAGAGGCAAGG + Intergenic
1164031399 19:21409177-21409199 AAGAATATATACAAGAGGCAGGG - Intronic
925518274 2:4709318-4709340 TTGGATATCCACCACAGGGATGG - Intergenic
926261470 2:11267669-11267691 TAGGATATACTCAAGGGGTATGG - Intronic
926261874 2:11271668-11271690 TAGGATATACTCAAGGGGTATGG + Intronic
928494414 2:31817480-31817502 TAGGATAGTTACCAGAGGCTTGG - Intergenic
931911254 2:66902604-66902626 TAGGATATAAAACAGAAACATGG - Intergenic
935123528 2:100202419-100202441 TAGGATGTACTGTAGAGGCAGGG + Intergenic
938693904 2:133817664-133817686 AATGATAGACACCAGAGGCTGGG + Intergenic
941498881 2:166243650-166243672 CAGAATGTACACAAGAGGCAAGG + Intronic
942873276 2:180762184-180762206 CAGGATATGCACAAGAGGCCTGG + Intergenic
943311850 2:186335027-186335049 TAGCATGTATACCAAAGGCAGGG - Intergenic
945369480 2:208999409-208999431 CAGGCTAGACTCCAGAGGCAGGG + Intergenic
947585888 2:231356541-231356563 TAGGAAAAACAACAGAGGAACGG + Intronic
1169412928 20:5389108-5389130 AATGATATATACCAGAGGCTAGG + Intergenic
1169641662 20:7758964-7758986 TAACAAATAAACCAGAGGCAAGG + Intergenic
1171119409 20:22555830-22555852 TAGTCTATAAAGCAGAGGCATGG + Intergenic
1172411165 20:34724198-34724220 TAGTGTATACACCACAGTCAGGG - Intronic
1174445384 20:50587550-50587572 TGGGATAGAAGCCAGAGGCAAGG - Intronic
1174590286 20:51639747-51639769 CAGGCTGCACACCAGAGGCATGG + Intronic
1175164898 20:57036461-57036483 TAGGATAAACACCAGACTCCTGG + Intergenic
1176980554 21:15376254-15376276 CAGGACATGCAACAGAGGCACGG - Intergenic
1179253043 21:39689604-39689626 AATGATAGACACCAGAGGCTAGG - Intergenic
1179369307 21:40789848-40789870 TAAGAAATACAGCAGAGGCCGGG - Intronic
1180226183 21:46393787-46393809 CAGGAGATGAACCAGAGGCAAGG - Intronic
1180739681 22:18044387-18044409 AAGGATAAACACCCGTGGCATGG + Intergenic
949174944 3:1049809-1049831 TAAGATATACACAAGTGGGAAGG + Intergenic
949684151 3:6549172-6549194 TATGATATGGACAAGAGGCAGGG + Intergenic
950405471 3:12801643-12801665 TAGGGTGGGCACCAGAGGCAAGG - Intronic
951134078 3:19083423-19083445 TATGATACAGACAAGAGGCAGGG + Intergenic
955698658 3:61661377-61661399 TAAGATATTCACCACAGTCAAGG - Intronic
957267025 3:77981311-77981333 CAGGATATACATAACAGGCAAGG + Intergenic
958424768 3:93967434-93967456 TAGGATATACACTAAGGCCAAGG - Intronic
958612471 3:96445397-96445419 TAAAATATACATCAGAGGCCAGG - Intergenic
961132574 3:124482805-124482827 CAGGAGATACAACAGCGGCATGG + Exonic
961211743 3:125130943-125130965 TAGCATTTACCCTAGAGGCAGGG - Intronic
962749736 3:138425001-138425023 TAGGACAAAGACCAGAGGAAGGG + Intergenic
965358062 3:167701848-167701870 CAGGATTTACAACAGAGCCACGG + Intronic
965756900 3:172036743-172036765 TAAGACTTACACCAGAGTCATGG - Intergenic
967043239 3:185713494-185713516 TAAGATAGACTCCAAAGGCAGGG + Intronic
969484009 4:7461710-7461732 CAGGATATAGCCCAGAGGCTTGG + Intronic
971051848 4:22870707-22870729 TAGGATTTCCACCAGAGGAATGG + Intergenic
977448191 4:97158747-97158769 AAGGATGTACACCACAGGGAAGG + Intergenic
978141018 4:105317343-105317365 TAAGATAAACACCAGATTCAGGG - Intergenic
982818137 4:159911805-159911827 TATGACATAATCCAGAGGCAGGG + Intergenic
984345717 4:178522179-178522201 GAGCATATACACCAGAGGGTGGG - Intergenic
985175382 4:187194806-187194828 TAGAATTGACAGCAGAGGCAAGG + Intergenic
985311327 4:188602996-188603018 TAGGATAGAAAACAGAGCCAGGG - Intergenic
986402322 5:7394378-7394400 TCTCATAGACACCAGAGGCAGGG - Intergenic
988014570 5:25537021-25537043 TAGGCTATACAACACAGCCAAGG - Intergenic
988735106 5:34012670-34012692 TAGGACATACATCAAAGTCATGG - Intronic
988987486 5:36635057-36635079 TCAGACATACACCAGAGCCATGG - Intronic
989558537 5:42825249-42825271 TATGATATGGACAAGAGGCAGGG + Intronic
990122415 5:52471287-52471309 TGGGATTTGCACCAGGGGCATGG + Intergenic
990728667 5:58784909-58784931 TGGGATACACACCAGACACATGG - Intronic
994502158 5:100592863-100592885 TAGGAGAAACATAAGAGGCAAGG - Intergenic
994728148 5:103460883-103460905 AAGGATAGTTACCAGAGGCAGGG + Intergenic
994817620 5:104604417-104604439 AAGGATAGTTACCAGAGGCAGGG + Intergenic
995230103 5:109751158-109751180 AAGGACAGACACCAGAGGCTGGG - Intronic
995759523 5:115548655-115548677 TAGGATATATTCCTGAGGAATGG + Intergenic
995971982 5:117983713-117983735 TTGGAGATACAGCAGGGGCAGGG - Intergenic
1001618113 5:173058150-173058172 TAGGATATACACCAGAGGCAGGG + Intronic
1001659149 5:173377716-173377738 TAGGAACTTCACCAGAGGGAAGG - Intergenic
1004997958 6:21212242-21212264 TGGGTTCTCCACCAGAGGCAGGG + Intronic
1011116284 6:83896437-83896459 AATGATAGACATCAGAGGCAGGG - Intronic
1019076603 6:169393323-169393345 TAGGACTTCAACCAGAGGCATGG + Intergenic
1021044167 7:15902343-15902365 TAGGATATAAACCAGAGGGCTGG + Intergenic
1021053505 7:16018666-16018688 TAAGATATATGCCAGAGGCCGGG - Intergenic
1021720809 7:23502457-23502479 AAGAATATACACCAGGGGCCGGG - Intergenic
1022580801 7:31552245-31552267 TAGGATATATAGCATAGTCATGG + Intronic
1024976853 7:55121363-55121385 TATGATATCTGCCAGAGGCACGG - Intronic
1026347542 7:69487520-69487542 TAAGATATACACCTTAGGCCAGG - Intergenic
1028632040 7:92945660-92945682 TATAAAATACACCACAGGCAGGG + Intergenic
1031762399 7:125730190-125730212 AAGGAAACAGACCAGAGGCATGG - Intergenic
1033294811 7:140122546-140122568 TATTATATACACCAGAGGCAAGG + Intronic
1037186739 8:16073436-16073458 TAGGTTTTTCACCAGATGCATGG + Intergenic
1038525331 8:28268011-28268033 TAGGACATGCATCAGGGGCAGGG + Intergenic
1043362317 8:79489090-79489112 AAGGGTATACACTACAGGCATGG - Intergenic
1043804501 8:84654591-84654613 AAGGATAGTTACCAGAGGCAGGG - Intronic
1044510348 8:93070153-93070175 TAGGAGAAACATCAGAGGTAAGG - Intergenic
1046296702 8:112229232-112229254 GAGGATATACAACATAGGCTTGG + Intronic
1046416303 8:113918105-113918127 TATAATAAACACCAGAGGCTGGG + Intergenic
1053613587 9:39741009-39741031 TAAGATATACACAAGGGGGAGGG + Intergenic
1053871628 9:42498966-42498988 TAAGATATACACAAGGGGGAGGG + Intergenic
1054239927 9:62601388-62601410 TAAGATATACACAAGGGGGAGGG - Intergenic
1054554060 9:66635914-66635936 TAAGATATACACAAGGGGGAGGG - Intergenic
1055362241 9:75505092-75505114 TAGGATAGACACCAGTGCCAAGG + Intergenic
1056310327 9:85334279-85334301 GGGGATATCCACCAGAGACAGGG + Intergenic
1056429543 9:86513760-86513782 TAGGAAAGACACCAGTGGCCTGG + Intergenic
1056807000 9:89736676-89736698 TAGGCCCTACACTAGAGGCAAGG + Intergenic
1062164282 9:135099030-135099052 TAGGAAACACACCCGAGGAAGGG - Intronic
1187069658 X:15875521-15875543 TAGGAGAAACACCAGAGAAATGG + Intergenic
1188285285 X:28319458-28319480 AATGATATAAACCAGAGGCTGGG + Intergenic
1188439935 X:30206614-30206636 CAAAATATACGCCAGAGGCATGG + Intergenic
1188970541 X:36610161-36610183 TGGGATATCCACTAGAAGCAAGG + Intergenic
1192958474 X:76100046-76100068 TAAGAAATACACCACAGACATGG - Intergenic
1193706589 X:84827661-84827683 TAGAATATACACAAAAGGAAAGG - Intergenic
1194787139 X:98100171-98100193 TAGGATGGTCACCAGAGGCTGGG - Intergenic
1197441701 X:126499139-126499161 TATGATATGCACTAGAGTCAGGG - Intergenic
1198538330 X:137608981-137609003 AAGGATGTTCACCAGAGGCTGGG + Intergenic