ID: 1001621918

View in Genome Browser
Species Human (GRCh38)
Location 5:173093944-173093966
Sequence GAGAGTAAAAAGTAGAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 883
Summary {0: 1, 1: 1, 2: 12, 3: 97, 4: 772}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001621918 Original CRISPR GAGAGTAAAAAGTAGAATGG AGG (reversed) Intronic
901609001 1:10482123-10482145 AAAAACAAAAAGTAGAATGGTGG - Intronic
902574029 1:17365874-17365896 AAAAAAAAAAAGTAGAATGGTGG + Intergenic
904292058 1:29493051-29493073 GGAAGCAGAAAGTAGAATGGTGG - Intergenic
905112643 1:35607998-35608020 AGAAGTAAAAAGTAGAATAGAGG + Intronic
905604370 1:39284386-39284408 GAGAGAAAAAGGAAGAATTGAGG + Exonic
905948362 1:41923447-41923469 AGGAGTAGAGAGTAGAATGGTGG + Intronic
906998486 1:50824907-50824929 GAAAGTAGAGAGTAGAATGATGG + Intronic
907969260 1:59364890-59364912 GGGAGTTGAAATTAGAATGGTGG + Intronic
908154307 1:61336685-61336707 GAGAGTAAAAAGATCAGTGGTGG - Intronic
908168108 1:61478278-61478300 CAAAGTATAAAGTAGAATAGAGG - Intergenic
908171939 1:61513409-61513431 TAAAGTAGAGAGTAGAATGGTGG - Intergenic
908602018 1:65750099-65750121 AGAAGTAGAAAGTAGAATGGTGG + Intergenic
909091615 1:71232958-71232980 GAGACTGAAAAGGTGAATGGGGG + Intergenic
909214833 1:72873808-72873830 GAGAGAAAAAAATAGAATTTAGG - Intergenic
909218098 1:72918011-72918033 CATAGTAGAGAGTAGAATGGTGG + Intergenic
909432073 1:75600010-75600032 TAGAGTAAAAAATAAATTGGAGG + Intronic
909869201 1:80718104-80718126 GGAAGTCAAAAGTAGAATGGAGG - Intergenic
910674330 1:89801499-89801521 GAGAATAAAAATTAAAATGTGGG - Intronic
910937810 1:92500152-92500174 AAGAGCAGAGAGTAGAATGGTGG - Intergenic
910946807 1:92601662-92601684 AAAAGTACAGAGTAGAATGGTGG + Intronic
911091994 1:94024594-94024616 GAGAGTAAAAATTTGGAGGGAGG - Intronic
911233941 1:95389647-95389669 GGAAGTAGAAAGTAGAATGATGG - Intergenic
911575132 1:99567151-99567173 TGGATTAAACAGTAGAATGGAGG + Intergenic
912039339 1:105367648-105367670 AACAGTAAAAAGTAGAAGAGAGG + Intergenic
913088835 1:115462367-115462389 GAGAGAAGAAAGAATAATGGTGG - Intergenic
913196344 1:116459439-116459461 AAGAGATAGAAGTAGAATGGTGG + Intergenic
914778703 1:150763248-150763270 AAAAGTAGAGAGTAGAATGGTGG + Intronic
915271442 1:154756485-154756507 GAGAGTAAACAGATGAAGGGGGG - Intronic
915536083 1:156536432-156536454 AGGAGTAGAGAGTAGAATGGTGG + Intronic
915614886 1:157029951-157029973 TAGAGAAAAAAGTAGATTAGTGG + Intronic
915700004 1:157783072-157783094 GAGAGAAGAAAGAAGAAAGGAGG - Intergenic
916801896 1:168223678-168223700 GACAGTGAAAAGTGGAGTGGGGG - Intergenic
917194165 1:172448766-172448788 GAAACTAAAAATTAGTATGGAGG + Intronic
917620633 1:176792039-176792061 CAGAGAATGAAGTAGAATGGAGG - Intronic
917830043 1:178873014-178873036 ATGAGGAAAAAGAAGAATGGTGG + Intronic
917856917 1:179108580-179108602 AAGGGTAAAGAGAAGAATGGTGG - Exonic
918224580 1:182469964-182469986 TAGAGAAAGAAGTAGAATGGTGG + Intronic
918339135 1:183552865-183552887 GAGGGTGGGAAGTAGAATGGGGG - Intronic
918933910 1:190895124-190895146 GAGACAGAAAAGTAGAATGCTGG - Intergenic
919008412 1:191928950-191928972 GAGAGGAAAAAGAAGAGTGGGGG + Intergenic
919041725 1:192397219-192397241 TAGAATACAAAGTAAAATGGAGG + Intergenic
919158134 1:193793329-193793351 AGGAGTAGAGAGTAGAATGGTGG + Intergenic
919464014 1:197910742-197910764 GAGATTAAAAGGTAAACTGGTGG + Intergenic
920663232 1:207937464-207937486 GAGAGTAAATGGTATAATGGAGG - Intergenic
920766063 1:208835077-208835099 GATAATAAAAAGAAGAAAGGAGG + Intergenic
920894231 1:210028454-210028476 AGGGGCAAAAAGTAGAATGGTGG - Intronic
921379921 1:214514047-214514069 GAGAGAAAAAAGGAAAATTGAGG - Intronic
921397054 1:214679617-214679639 GAGAAGAAGAAGAAGAATGGAGG - Intergenic
921781298 1:219168179-219168201 TAGAAAAAAAAGTATAATGGTGG - Intergenic
921967723 1:221108397-221108419 AAAAGCAAAAAGTAGAATAGTGG + Intergenic
922994081 1:229942192-229942214 CAGATTAAAAAGTAGAATAGAGG + Intergenic
923052161 1:230396424-230396446 GAGAGTGAAAGGGAGGATGGTGG - Intronic
923175474 1:231460167-231460189 GGAAGTACAGAGTAGAATGGTGG + Intergenic
923184298 1:231555363-231555385 GAGACAAGAAAGTAGAATGGTGG + Intronic
923589552 1:235307085-235307107 GAGAAAAAAAATTATAATGGGGG + Intronic
923642081 1:235773593-235773615 ATTAGTCAAAAGTAGAATGGTGG + Intronic
924006353 1:239615939-239615961 GAGAGGAAGAAGTAGAAGGAAGG - Intronic
924654915 1:245965693-245965715 GATAGTAAAAAGATCAATGGTGG + Intronic
924807931 1:247376149-247376171 GAGAGTAAAAACTGCAAAGGGGG - Intergenic
1063280297 10:4621372-4621394 TAGAGTATAGAGTAGAATGGTGG + Intergenic
1063301100 10:4849571-4849593 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1063662660 10:8044815-8044837 GAGAGATGAAAGTAGAATGGGGG + Intergenic
1064995763 10:21295800-21295822 GAGAGTAAAAACAAGAGTAGCGG + Intergenic
1066594322 10:37032590-37032612 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1066798384 10:39152993-39153015 AAGAGTAAAAACTAGAAGGAAGG + Intergenic
1067026841 10:42849888-42849910 GAAAGTAGAGAGTAGAATTGTGG + Intergenic
1068000489 10:51328159-51328181 AAAAGTAAAAAGTAGAATGGTGG - Intronic
1068510096 10:57954904-57954926 GTGAGTGAGAAGGAGAATGGAGG + Intergenic
1068574722 10:58672272-58672294 GAGAGAAGAAAGTAGAATGGTGG - Intronic
1068877610 10:62013606-62013628 AGGAGTAGAGAGTAGAATGGTGG - Intronic
1068903034 10:62291278-62291300 GAGTGAAAAAAGCAGAATTGTGG + Intergenic
1068984336 10:63093118-63093140 CTGAGTAGAGAGTAGAATGGTGG - Intergenic
1069067414 10:63958100-63958122 GAGAGTAACAAGAAGTATGAGGG - Intergenic
1069110069 10:64436158-64436180 GAGAGGAAAAAGTAGATTTCAGG - Intergenic
1069270286 10:66517929-66517951 GATAATAAAAAGTAGACTGATGG - Intronic
1069997212 10:72349783-72349805 GAGAGCCCAAAGGAGAATGGGGG + Intronic
1070507006 10:77122723-77122745 GAGACTAAAAGGTAAAATGAAGG + Intronic
1070899112 10:80012544-80012566 CAGAACAGAAAGTAGAATGGTGG + Intergenic
1071310092 10:84335204-84335226 GAGAGAGAGAAGTAGAATGCTGG - Intronic
1071961977 10:90815793-90815815 GAGAGTAAAAGCTAGAATGCTGG + Intronic
1072268170 10:93750564-93750586 AGGAGTAAAAAGTAGAACAGAGG - Intergenic
1072347824 10:94526116-94526138 AAAAGTAAAAAGTAGAACAGAGG - Intronic
1072532637 10:96333786-96333808 CAGAATAGAATGTAGAATGGTGG + Intronic
1072935448 10:99708114-99708136 GAGAATAAATAGAAGATTGGTGG - Intronic
1072957097 10:99896882-99896904 TAGAGATAAAAGTAGAAGGGTGG + Intronic
1073489362 10:103842568-103842590 GGTAGTGAAGAGTAGAATGGCGG - Intronic
1073828205 10:107350894-107350916 GAGATTAAAAAATATAATTGAGG + Intergenic
1074624532 10:115166085-115166107 GAGACAGAAAAGTAGATTGGTGG - Intronic
1075400910 10:122160922-122160944 GAGAGAAACAAATAGAATGTGGG - Intronic
1075962091 10:126576959-126576981 AGGAGTAAAAAGTAGAACAGAGG + Intronic
1076225085 10:128768138-128768160 TAGAGTACAAAGCAGAAAGGTGG + Intergenic
1077820394 11:5732226-5732248 TGTAGTAGAAAGTAGAATGGTGG - Intronic
1078526773 11:12107436-12107458 GAGAGAAAAAAGAAGAAGGAAGG - Intronic
1078571870 11:12465551-12465573 GAGAGTAAAAAGATAAATGGGGG - Intronic
1079336466 11:19574772-19574794 AAAAGTAGAAAATAGAATGGTGG + Intronic
1079519021 11:21302753-21302775 GAAAACAAAAAGGAGAATGGGGG + Intronic
1079523276 11:21354346-21354368 GAGAGTAGAAAGAAGGAGGGAGG - Intronic
1079648837 11:22900887-22900909 GAGAGTAAGAAGGAGATAGGTGG + Intergenic
1079822865 11:25152991-25153013 GGGGGTAGAAAGCAGAATGGTGG - Intergenic
1079879170 11:25903101-25903123 AGAAGTAAAAAGTAGAATGATGG - Intergenic
1079950968 11:26803924-26803946 GTGAGAAAAAAGGAGCATGGTGG - Intergenic
1080263212 11:30373357-30373379 GAGAGAAAAAAGAACAATTGTGG - Intergenic
1080636372 11:34127316-34127338 GCCAGGAAAAAGTAGAAAGGAGG + Intronic
1080674077 11:34408603-34408625 CAGAGTACAGATTAGAATGGAGG + Intergenic
1080843867 11:36009030-36009052 GAGAGAAAAAAATACAAAGGAGG - Intronic
1080949627 11:37016494-37016516 AAGAGTAGAAAGTATAATTGTGG + Intergenic
1080989514 11:37513807-37513829 GAAGATAAAGAGTAGAATGGTGG + Intergenic
1081058072 11:38435590-38435612 TATAGTAGAAAGTAGAATGGTGG - Intergenic
1081280069 11:41198620-41198642 GAGAGGAAAAAAAAGTATGGAGG + Intronic
1081415126 11:42805593-42805615 TAGAGACAGAAGTAGAATGGTGG + Intergenic
1081923176 11:46798652-46798674 GAGACAAAAAAGTAGATTAGTGG + Intronic
1082614847 11:55347226-55347248 AACAGTAGAAAGTAGAATAGTGG - Intergenic
1082665965 11:55976609-55976631 GGAAGTAAAGAATAGAATGGTGG - Intergenic
1082861442 11:57860571-57860593 AGGAGTAAAAAGTAGAACAGAGG + Intergenic
1083549155 11:63573300-63573322 GAAATAAAAAAATAGAATGGAGG - Exonic
1083947339 11:65931483-65931505 GTGAGTAGAAATTAGACTGGAGG - Intergenic
1084394859 11:68902828-68902850 GACAGTAAAAAGTTACATGGGGG - Intronic
1085362247 11:75900370-75900392 GAGAGAAAAAAAGAGAATGAGGG - Intronic
1085703426 11:78764916-78764938 AAGGATAAAAAGGAGAATGGGGG + Intronic
1086276895 11:85140758-85140780 GAGAGAAAAGAGTATAATGATGG - Intronic
1086473589 11:87145134-87145156 CATAGCAGAAAGTAGAATGGTGG - Intronic
1086564340 11:88208402-88208424 TAGAGTAAAGAGTAGAATAGTGG - Intergenic
1086624008 11:88923511-88923533 TAGAGTAGACAGTAGAATGATGG + Intronic
1086670064 11:89535558-89535580 GAAAGCAAAAAGCAGAAAGGAGG - Intergenic
1086761710 11:90639384-90639406 AAGAGAAAAAAGGAGAGTGGGGG + Intergenic
1086844191 11:91728184-91728206 GAGATTCAAGACTAGAATGGGGG - Intergenic
1087186072 11:95197292-95197314 AAAAGCAAAAGGTAGAATGGTGG - Intronic
1087230863 11:95661366-95661388 AGAAGTAGAAAGTAGAATGGTGG - Intergenic
1087595609 11:100250945-100250967 GAGATGAATAAATAGAATGGAGG + Intronic
1087977831 11:104571910-104571932 GGAAGCAGAAAGTAGAATGGTGG + Intergenic
1088033883 11:105287810-105287832 GAGGGTAGAGAGTGGAATGGTGG + Intergenic
1088044156 11:105427336-105427358 GAAGGTAAAGAGTTGAATGGTGG + Intergenic
1088596100 11:111441458-111441480 GAGAGTTGAAAGAAGAAGGGTGG - Intronic
1088668073 11:112114547-112114569 GAAAGAAAAAAGTATAATAGAGG + Intronic
1088999677 11:115041301-115041323 GAGAGAGAGAAGTAGAGTGGAGG + Intergenic
1089686740 11:120154684-120154706 GAAAACAGAAAGTAGAATGGTGG - Intronic
1090122461 11:124046492-124046514 GAAAGTAAAGAGTAGAACTGTGG + Intergenic
1090661925 11:128888607-128888629 GAGACCAAAAGGTATAATGGTGG - Intergenic
1090708228 11:129359485-129359507 AAAAGTAGAAAGTAGAATGATGG - Intergenic
1090816362 11:130300118-130300140 GAGACAGAAAAGTAGAAGGGTGG + Intronic
1091320244 11:134644466-134644488 GAGAGTAGAAAGAAGAGTGAAGG - Intergenic
1091638663 12:2217214-2217236 TAGAGACAGAAGTAGAATGGTGG + Intronic
1091864919 12:3824621-3824643 GAGAGAACTAAGCAGAATGGAGG - Intronic
1092156225 12:6283390-6283412 CAGAGACAGAAGTAGAATGGCGG + Intergenic
1092314814 12:7399423-7399445 AAGAGGAAGAAGAAGAATGGGGG - Intronic
1092803365 12:12194885-12194907 AAAAGTAAAGAGTAGAATAGGGG - Intronic
1093038806 12:14356506-14356528 GAGAGAAAAAAAAAGAAAGGAGG - Intergenic
1093324119 12:17752421-17752443 GATAGTACATGGTAGAATGGTGG - Intergenic
1093370399 12:18357808-18357830 GAAAGCAAAAAGTAGAATGTTGG - Intronic
1093412232 12:18880479-18880501 GAGAGTAATAAGTAGATGAGGGG + Intergenic
1093734606 12:22606348-22606370 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1093747007 12:22753405-22753427 GATAGAAAAAAGTATAATAGAGG + Intergenic
1093850538 12:24031490-24031512 AGAAGTAGAAAGTAGAATGGTGG + Intergenic
1093923358 12:24884304-24884326 GGAAGTAGAGAGTAGAATGGTGG + Intronic
1095829063 12:46563668-46563690 AGGAGTAAAAAGTAGAACAGAGG - Intergenic
1095846593 12:46752480-46752502 AGAAGCAAAAAGTAGAATGGTGG + Intergenic
1095896885 12:47288761-47288783 GAGAAAAGAAAGTAGAATGTAGG - Intergenic
1096435169 12:51583913-51583935 AAAAGTAAAGAGTAAAATGGTGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096885243 12:54711916-54711938 GGAAGTATAGAGTAGAATGGTGG - Intergenic
1097126475 12:56780229-56780251 GGGTGTAAAAAGTAAAGTGGAGG + Intronic
1097397714 12:59095948-59095970 TAGATTAAAAGGTAGAATCGAGG - Intergenic
1097495634 12:60328694-60328716 GAGAGTAAAAAGTAGAAAAATGG - Intergenic
1097507357 12:60491848-60491870 GAGAGTAAAATGTTCCATGGGGG + Intergenic
1097618507 12:61911712-61911734 GAGAGTCACAAATAGAATTGAGG + Intronic
1097971990 12:65643174-65643196 AGAAGTAAAGAGTAGAATGGTGG - Intergenic
1097977281 12:65700537-65700559 GAGAGTAGAGAGTAAAATAGTGG - Intergenic
1098042204 12:66363794-66363816 AGAAGCAAAAAGTAGAATGGTGG + Intronic
1098881542 12:75922265-75922287 GAGAGGAAATGGAAGAATGGTGG - Intergenic
1099282311 12:80666374-80666396 GAAAGTAGAGAGTAGAATAGTGG + Intronic
1099607548 12:84824303-84824325 GGAAGCAGAAAGTAGAATGGTGG - Intergenic
1099718958 12:86336591-86336613 GAGAATAAAAAGTATAATAGAGG + Intronic
1099840695 12:87961905-87961927 GGAAGTAGAAAGTAGAATAGTGG - Intergenic
1100173275 12:92001581-92001603 AGAAGTAAAAAGTAGAATAGAGG + Intronic
1100400909 12:94228595-94228617 GAGACAAAAAATTAGAATGGCGG - Intronic
1100452357 12:94719781-94719803 AGAAGTAGAAAGTAGAATGGTGG + Intergenic
1100773229 12:97947075-97947097 GAGAGTGATAAGTTGTATGGAGG + Intergenic
1100806640 12:98292466-98292488 AAGAGAGAAAAGAAGAATGGAGG + Intergenic
1100933322 12:99635560-99635582 AGAAATAAAAAGTAGAATGGTGG + Intronic
1100939698 12:99712689-99712711 CAGATCAAAAAGTACAATGGTGG + Intronic
1101469786 12:104985878-104985900 CAAAGAAGAAAGTAGAATGGTGG + Intergenic
1101797986 12:107993871-107993893 AAAAGTAAAGAGTAGAATAGTGG - Intergenic
1102288481 12:111679479-111679501 AAGATTAAAAAGTCCAATGGGGG - Intronic
1102734294 12:115144530-115144552 GGAAGTAGAGAGTAGAATGGTGG + Intergenic
1103858259 12:123990091-123990113 GAGTCAAGAAAGTAGAATGGTGG + Intronic
1104200840 12:126587214-126587236 TAGAGACAGAAGTAGAATGGTGG + Intergenic
1104488161 12:129169839-129169861 AAGAATAAAAGGTAGAATAGTGG - Intronic
1106061173 13:26293951-26293973 AAAAGTAGAGAGTAGAATGGTGG - Intronic
1106111175 13:26778420-26778442 GAAAGTATTAAATAGAATGGCGG - Intergenic
1106350818 13:28929123-28929145 GAAGGTAAATAGTAGATTGGTGG + Intronic
1106382263 13:29251602-29251624 GAGATGAGAAAGTAGAATGGCGG - Intronic
1106945690 13:34824983-34825005 GAGAGTAGAAAGGAGAATGGTGG - Intergenic
1107132040 13:36907197-36907219 TAGAGAAGAAAGTAGAATGAAGG + Intronic
1107361825 13:39626417-39626439 CATAGTAGGAAGTAGAATGGTGG - Intergenic
1107829191 13:44359415-44359437 GAGGGTGAAAAGTAGGAGGGAGG - Intergenic
1108057111 13:46496075-46496097 TAGAGTAAAAAGTAGATTTGGGG + Intergenic
1108806492 13:54162871-54162893 GAGAGAAAGAACTAGAATGTAGG - Intergenic
1109138157 13:58679641-58679663 AACAGCAAAAAGTAGAATGGTGG - Intergenic
1109364118 13:61333509-61333531 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1109418296 13:62073761-62073783 TAAAGTAGAGAGTAGAATGGCGG - Intergenic
1109425941 13:62166637-62166659 GAAAGTAGAAAGTACATTGGTGG - Intergenic
1109986044 13:69986139-69986161 GTAAGTAAAGAGTAGAATAGTGG + Intronic
1110144650 13:72175636-72175658 AAGAGTAAAAAGTATTATTGGGG - Intergenic
1110490786 13:76103513-76103535 GAGAAGAGAAAGTAGAATTGTGG + Intergenic
1110724142 13:78800180-78800202 GAGAGTAAAAAGACCAGTGGTGG - Intergenic
1110772931 13:79370597-79370619 AACAGTAAGAAGTAGAATAGCGG + Intronic
1110904442 13:80867863-80867885 GAGAAAATAAAGGAGAATGGAGG + Intergenic
1110984091 13:81941091-81941113 AAAAGTAAAGACTAGAATGGTGG - Intergenic
1111137968 13:84075424-84075446 TAGAGTAATTAGCAGAATGGTGG - Intergenic
1111336320 13:86828860-86828882 AAAAGTAAATAATAGAATGGTGG - Intergenic
1111465556 13:88604160-88604182 AAAAGTAGAAAATAGAATGGTGG + Intergenic
1111882056 13:93969753-93969775 GAGGATAGAGAGTAGAATGGTGG - Intronic
1112014564 13:95320848-95320870 GAAAGTAGAGAGTAGAATGATGG + Intergenic
1112234373 13:97622101-97622123 GAGAGGCGAAAGTGGAATGGAGG + Intergenic
1112526066 13:100148422-100148444 CAGAGGAAAAAGTAGAGTAGGGG - Intronic
1112553559 13:100445596-100445618 TAGAGTAGAAAATAGAATGGTGG - Intronic
1112791589 13:103008466-103008488 GAGATTAACAAGTGTAATGGAGG - Intergenic
1112902676 13:104378074-104378096 GGAAGTAGAAAGTAGAATGGTGG - Intergenic
1113497165 13:110740213-110740235 AAGAATAAAAAGGAGATTGGAGG + Intergenic
1114660867 14:24343384-24343406 TAGAGATGAAAGTAGAATGGTGG + Intergenic
1114682731 14:24499958-24499980 CATAGAAATAAGTAGAATGGTGG - Intergenic
1115214667 14:31002798-31002820 GACAGAAAGTAGTAGAATGGTGG + Intronic
1116141082 14:40995107-40995129 TAGAGTAATAAGTAGAATCTTGG - Intergenic
1116537718 14:46056178-46056200 GGAAGTAGAAAGTAGAACGGTGG - Intergenic
1116611493 14:47078970-47078992 AAAAGTAGAAAGTAGAATGGTGG - Intronic
1116981218 14:51172906-51172928 AAGAACAGAAAGTAGAATGGTGG - Intergenic
1117879830 14:60302536-60302558 GAGAGTTAAAAACATAATGGGGG - Intergenic
1117927751 14:60802082-60802104 AGAAGTAAAGAGTAGAATGGTGG + Intronic
1118012015 14:61619161-61619183 TAAAACAAAAAGTAGAATGGTGG + Intronic
1118394717 14:65326210-65326232 GGAAGTAAAAAGTAGAACAGAGG + Intergenic
1118617323 14:67583246-67583268 GGGAATAAAAACTACAATGGAGG - Intronic
1119116983 14:72032634-72032656 AGAAATAAAAAGTAGAATGGTGG - Intronic
1119130330 14:72166802-72166824 CAGAGAAGAAAATAGAATGGTGG - Intronic
1119593980 14:75916991-75917013 AAAGGTAGAAAGTAGAATGGTGG + Intronic
1119632165 14:76242570-76242592 GAAAATACAGAGTAGAATGGTGG + Intronic
1120067861 14:80065658-80065680 AAAAGTAGACAGTAGAATGGTGG + Intergenic
1120068458 14:80074390-80074412 AAGGGGAAAAAGTAGAAAGGGGG + Intergenic
1120182759 14:81362443-81362465 AGAAGTAAAAAGTAGAATGGTGG + Intronic
1120187788 14:81412545-81412567 CAGAATAGAAAGTAGAATGGTGG + Intronic
1120366045 14:83570977-83570999 GCTAGTAAAATGTACAATGGAGG + Intergenic
1120428882 14:84388439-84388461 CAAAGAAAAGAGTAGAATGGCGG + Intergenic
1120445905 14:84595567-84595589 AAAAGTAGAAACTAGAATGGAGG - Intergenic
1120461436 14:84802259-84802281 GAGAGAAAAAAATAGACTCGTGG + Intergenic
1121092329 14:91191257-91191279 CAGGGCAGAAAGTAGAATGGTGG + Intronic
1121454971 14:94032453-94032475 GAGACAGAAAAGTAGAAAGGTGG + Intronic
1121785333 14:96654954-96654976 TAGACTGCAAAGTAGAATGGTGG - Intergenic
1122394941 14:101418699-101418721 CAGTGTAAATGGTAGAATGGAGG + Intergenic
1122764608 14:104057763-104057785 GACAGTAAAAAGATGAGTGGTGG - Intergenic
1123508205 15:20967447-20967469 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1123565425 15:21541194-21541216 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1123601689 15:21978483-21978505 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1123681098 15:22764668-22764690 CTGAGACAAAAGTAGAATGGTGG - Intergenic
1123799691 15:23806897-23806919 AGAAGTAGAAAGTAGAATGGAGG + Intergenic
1123847571 15:24318329-24318351 AAGTGTAAAAAGTAAAATAGAGG + Intergenic
1123866617 15:24525712-24525734 AAGTGTAAAAAGTAGAATAGAGG + Intergenic
1124331666 15:28822966-28822988 TAAAGTATAAAATAGAATGGAGG + Intergenic
1124333315 15:28839129-28839151 CTGAGACAAAAGTAGAATGGTGG - Intergenic
1125046204 15:35244259-35244281 GGGAGGAAAAAGTGGAAAGGGGG - Intronic
1125131655 15:36290084-36290106 GGGAGTAGAAGGAAGAATGGAGG + Intergenic
1125214524 15:37255227-37255249 GAAAGTGAAAAACAGAATGGTGG + Intergenic
1125699598 15:41670398-41670420 AAAAGTAGAAAGTAGAATGGTGG + Intronic
1125837187 15:42762927-42762949 GTAAGTAAAAAGTAGAAGAGAGG + Intronic
1126198937 15:45963568-45963590 TTGAGTAAAAAGGAGAAGGGAGG + Intergenic
1126659483 15:51018203-51018225 GGAAGTAAACAGTAGAATTGTGG - Intergenic
1126741893 15:51785634-51785656 GGAGGTAAAGAGTAGAATGGTGG + Intronic
1128434271 15:67630079-67630101 AAAAGTAAAAAGTAGCATGGTGG + Intronic
1128885434 15:71282617-71282639 TAGAGTGTAAAGTGGAATGGTGG - Intronic
1128917794 15:71580671-71580693 GAAAGCAGAGAGTAGAATGGTGG - Intronic
1128925464 15:71651262-71651284 GAGAGATGAAATTAGAATGGAGG - Intronic
1129249063 15:74298314-74298336 GAGAGGAAAAAATAGAGTGGAGG + Intronic
1129565363 15:76616429-76616451 AATAATAGAAAGTAGAATGGTGG + Intronic
1130790306 15:87147883-87147905 AAAAGTAAAAAGTAGAACAGAGG + Intergenic
1131838444 15:96412914-96412936 GAGAGTAGAAAGCAGAGTGAGGG + Intergenic
1202973797 15_KI270727v1_random:268284-268306 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1133290352 16:4716567-4716589 CAGAGTCAAAAGTAGGATGGGGG - Intronic
1133530318 16:6649146-6649168 TATACTAAAAAGTACAATGGTGG - Intronic
1133541345 16:6757607-6757629 GAGGATAGAGAGTAGAATGGTGG + Intronic
1135177342 16:20242339-20242361 GACAGGAAAAAGGAGAAAGGTGG + Intergenic
1135770583 16:25215147-25215169 TAGAGACAGAAGTAGAATGGTGG - Intergenic
1136591553 16:31220868-31220890 GAGAGAGAAAAAGAGAATGGTGG - Intronic
1137033822 16:35551343-35551365 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1138357800 16:56398841-56398863 GAGTCAAAAAAATAGAATGGTGG + Intronic
1138795707 16:59966033-59966055 GACTGTAAAAAGTAAAATAGAGG - Intergenic
1139005356 16:62563697-62563719 CAGCGTAGAAGGTAGAATGGGGG + Intergenic
1139097611 16:63723893-63723915 GAGTGTGAAAAGAAGAATTGGGG + Intergenic
1139208961 16:65057499-65057521 GAGTGTATAAAGTGGAATGAAGG + Intronic
1140084147 16:71778763-71778785 GGGGGGAAAAAGTACAATGGGGG + Intronic
1140412791 16:74751478-74751500 GAGTGTAACACATAGAATGGAGG - Intronic
1140493712 16:75364280-75364302 GACAGCAAAGGGTAGAATGGAGG - Intronic
1141409146 16:83820746-83820768 GAGAGAGAAAAGAAGAAGGGAGG - Intergenic
1142938915 17:3364520-3364542 TACAGTAGAGAGTAGAATGGTGG - Intergenic
1143035944 17:3998294-3998316 GAAAACAAAAAGTAAAATGGCGG - Intergenic
1143857624 17:9863956-9863978 GGTAGAACAAAGTAGAATGGAGG + Intronic
1144227723 17:13167038-13167060 AAGATTAAAAAGTAGATTAGTGG - Intergenic
1144350701 17:14393251-14393273 AAAAGTAGAAAGTAGAATAGTGG + Intergenic
1144434243 17:15224705-15224727 GAGAAAAAAAAGTAGATTAGTGG - Intergenic
1146235610 17:31158121-31158143 AAGAGTAAAAAGTAGAAGAGAGG - Intronic
1146274315 17:31506570-31506592 AGAAGTAGAAAGTAGAATGGTGG - Intronic
1146423956 17:32718270-32718292 CAGACTAGAAAGCAGAATGGGGG - Intronic
1146961263 17:36982031-36982053 CAGAGAGAAAAGCAGAATGGTGG - Intronic
1146964540 17:37013908-37013930 AAGGGGAAAAAGTAGAAGGGAGG - Intronic
1146969105 17:37058031-37058053 GGAACTAAAGAGTAGAATGGTGG + Intergenic
1147507310 17:41032302-41032324 GGAAGTAGAAAGTAGAATGGTGG + Intergenic
1148260638 17:46180115-46180137 TAGAGGAAATAGTAGAATGAAGG + Intronic
1148574700 17:48701559-48701581 TGGACTAAACAGTAGAATGGAGG - Intergenic
1148866529 17:50631619-50631641 GAGAGAAGAAAGCAGAATGGGGG - Intergenic
1148971326 17:51485110-51485132 GAGAGAAAAAAGTAATATAGGGG - Intergenic
1148981762 17:51582827-51582849 GAAATCAGAAAGTAGAATGGTGG - Intergenic
1149185532 17:53992782-53992804 TAGAATAAAAAGTGGAATGGTGG - Intergenic
1149207913 17:54269705-54269727 GAGAGAAAAAATGAGAATGTTGG - Intergenic
1149279473 17:55086577-55086599 GGAAGTAAAAAGTAGAACAGAGG - Intronic
1150194277 17:63278902-63278924 CAGAATAGAAAGTAGAATAGTGG + Intronic
1150638897 17:66936220-66936242 TAGAGACAAAAGTAGAATGGTGG - Intergenic
1151487804 17:74412539-74412561 GAGAGTGAAAAACAGAACGGTGG - Intergenic
1203171336 17_GL000205v2_random:149785-149807 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1153066815 18:1055083-1055105 AAAAGCAAAGAGTAGAATGGTGG - Intergenic
1153260444 18:3218831-3218853 GAGAGTAAAAAATAGTATTGGGG - Intronic
1153843329 18:9026656-9026678 CAAAGTAAAAACTAGAATAGAGG + Intergenic
1153878089 18:9394370-9394392 GCAAGTAAAAAGTAGAACGGAGG + Intronic
1153946170 18:10019616-10019638 GGAAGTAAAAAGTAGAACAGAGG + Intergenic
1154075973 18:11202014-11202036 GACAGTAAAAAGTTCAGTGGTGG - Intergenic
1154414571 18:14170281-14170303 GAGACAAAAAACTAGAATAGTGG + Intergenic
1154469521 18:14685322-14685344 AGGAGTAGAGAGTAGAATGGTGG - Intergenic
1155407297 18:25503028-25503050 GGAAGTAGCAAGTAGAATGGTGG + Intergenic
1155440638 18:25858373-25858395 AGAAGTAATAAGTAGAATGGAGG + Intergenic
1155641661 18:28024881-28024903 AAGAGTAAAAAGAAAAAGGGAGG + Intronic
1156296861 18:35800232-35800254 GAAAGTGAAAAACAGAATGGTGG + Intergenic
1156884708 18:42121653-42121675 CAGGGTAAAAAGTAGATTGGAGG - Intergenic
1156901367 18:42303867-42303889 GAGAGTAAATGGTATAGTGGAGG - Intergenic
1157787046 18:50493372-50493394 GAAAGAAAAAACTAAAATGGTGG + Intergenic
1157864527 18:51169280-51169302 GAGAGAAAAATCAAGAATGGGGG - Intergenic
1157894587 18:51453147-51453169 GAGAGTAAAATGGAGAAATGAGG + Intergenic
1158269773 18:55699977-55699999 GAAAGAAAAAAGTAAAATGTAGG - Intergenic
1158578032 18:58656768-58656790 TCTAGTCAAAAGTAGAATGGTGG - Intergenic
1158637319 18:59171964-59171986 GGAGGTAAAAAGTAGAATGATGG + Intergenic
1158915447 18:62122000-62122022 GGGAGTAGAGAGTAGACTGGTGG + Intronic
1159820858 18:73141664-73141686 GAAAGAGAAAAGTAGAATGATGG - Intergenic
1159834503 18:73321881-73321903 TAAAGTAGAAAGTAGAGTGGTGG - Intergenic
1159854953 18:73575024-73575046 AGAAGTAGAAAGTAGAATGGTGG - Intergenic
1159976495 18:74719360-74719382 GCAAGTAAAAAGTAGAACAGAGG - Intronic
1160274964 18:77423233-77423255 GAGATTAAAAAACAGAATGAAGG - Intergenic
1160374703 18:78402567-78402589 GAAAGTCAAAAATAGAATGTGGG + Intergenic
1162614547 19:11787044-11787066 GAGAGTAAAGAGTAGAATTGAGG - Intergenic
1163045543 19:14638813-14638835 AGGAGTAGAGAGTAGAATGGAGG - Intronic
1163389307 19:17020683-17020705 GAGAGGAACAAGGAGAAGGGTGG + Intronic
1164550890 19:29211786-29211808 CAGAGTAAAAAGAAAAGTGGCGG + Intronic
1166165291 19:40983630-40983652 AAAAGCAAAGAGTAGAATGGGGG + Intergenic
1166176283 19:41073771-41073793 GAAAGTGGAAAGTAGAATGTTGG + Intergenic
1166963060 19:46511207-46511229 GAGAGTCAAAAGAACAATGCAGG + Intronic
1167024007 19:46901204-46901226 GTGAGAAAAAGGCAGAATGGTGG + Intergenic
1167047769 19:47060884-47060906 GAAAGTAAAAGGAAGAAGGGTGG + Intergenic
1168053883 19:53850152-53850174 AGAAGTAAAGAGTAGAATGGGGG + Intergenic
1168191945 19:54745011-54745033 GAAGGTAGAGAGTAGAATGGTGG - Intronic
1168194227 19:54761567-54761589 GAAGGTAGAGAGTAGAATGGTGG - Intronic
1168196274 19:54776299-54776321 GAAGGTAGAGAGTAGAATGGTGG - Intronic
1168199936 19:54807086-54807108 GAAGGTAGAGAGTAGAATGGTGG - Intronic
1168570229 19:57460913-57460935 AAAAGTAGAGAGTAGAATGGTGG - Intronic
925973286 2:9122875-9122897 CAGAGAAAAAAGTAGATTCGTGG + Intergenic
926464660 2:13172742-13172764 GAGAGGAAAAAGTATAATGCCGG - Intergenic
926805895 2:16710725-16710747 AAGAGTAGAAAGAAGAATGATGG + Intergenic
926824084 2:16884827-16884849 GAGAGTAAAAGGAAGAATAAAGG - Intergenic
926968688 2:18444443-18444465 TAGAGGAAAAAGGAGAAAGGGGG + Intergenic
927659595 2:24981626-24981648 TAGAGACAAAAGTAGAATGATGG - Intergenic
928017859 2:27675267-27675289 GAGACAGAAAAGTAGAATGGTGG - Intronic
928887448 2:36165960-36165982 TAGAGACACAAGTAGAATGGGGG + Intergenic
928934179 2:36657452-36657474 GAAAGGAAAAAGCAGAATGGTGG + Intergenic
929271487 2:39977126-39977148 GAGAGTGAAGAGGAGACTGGTGG + Intergenic
929292487 2:40209416-40209438 GAGAGTTAAGAGTAGAGTGAGGG + Intronic
929653308 2:43704202-43704224 AGGAATAGAAAGTAGAATGGCGG + Intronic
929738044 2:44572173-44572195 CAGAGACAAAAGTAGAATGGTGG - Intronic
930326140 2:49921322-49921344 GAGAGGAAAAAAAAGTATGGAGG - Exonic
930654710 2:53996344-53996366 GAGATAAAAAAGGAGGATGGAGG + Intronic
931023447 2:58078177-58078199 GAAACAAAAAAGTAGAATGCTGG - Intronic
931345621 2:61443095-61443117 GTAAGTAAAAAGTAGAACAGAGG + Intronic
931409472 2:62015208-62015230 CAGAGAAAAAAGTAGAAAAGAGG - Intronic
931752888 2:65346549-65346571 GAGACAAGACAGTAGAATGGTGG - Intronic
931890825 2:66670193-66670215 GAAAGTAGAATGTAGACTGGTGG + Intergenic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932802366 2:74752238-74752260 GAGAGTAAATAGTGGAGTTGGGG + Intergenic
933161187 2:79026670-79026692 GAGAGTAAAATGAAGAGTAGGGG - Intronic
933188622 2:79307405-79307427 AGAAGTAAAAAGTAGAATAGAGG - Intronic
933279710 2:80319663-80319685 CAGAGTGAAAAGCAGAATTGTGG - Intronic
933343649 2:81054247-81054269 AGAAGTATAAAGTAGAATGGTGG - Intergenic
933440653 2:82309458-82309480 AGAAGTAGAAAGTAGAATGGTGG + Intergenic
933841918 2:86294107-86294129 AAAAATAGAAAGTAGAATGGTGG + Intronic
933858068 2:86437012-86437034 AAGAGAAAAAAGTAGAAGAGAGG + Intergenic
934029949 2:88034839-88034861 GGAAGTAGAGAGTAGAATGGTGG - Intronic
934702089 2:96450702-96450724 GAGAGCAAAAAAGAGAAAGGAGG + Intergenic
934916816 2:98306844-98306866 AAGAGTAGAAATTACAATGGGGG - Intronic
935033957 2:99349972-99349994 AAAAGTAAAGAGTAGAATAGTGG - Intronic
935957572 2:108393064-108393086 GAAGATAAAAAGTAGAATGATGG - Intergenic
936709267 2:115112673-115112695 GAAAGTAAAGAGTAAAATGGTGG + Intronic
936805245 2:116323924-116323946 GGAAGTAGACAGTAGAATGGTGG - Intergenic
936889924 2:117357363-117357385 CAGAGTAGAAAGTAGTTTGGTGG - Intergenic
937049000 2:118873292-118873314 GAAAGTTTGAAGTAGAATGGGGG + Intergenic
937492173 2:122381477-122381499 GAGAAGAAAGATTAGAATGGAGG + Intergenic
937562357 2:123241661-123241683 TAGAGCCAGAAGTAGAATGGTGG + Intergenic
938196026 2:129329199-129329221 AGGAGCAAAGAGTAGAATGGTGG + Intergenic
938420600 2:131143011-131143033 GAAAGTGAAAAACAGAATGGGGG - Intronic
938771008 2:134500784-134500806 AAGAGTAAAAAGTAAAACAGAGG + Intronic
939724879 2:145705608-145705630 AAGAGCATAAAGTAGAATAGTGG - Intergenic
939978334 2:148747297-148747319 AGGAGTAAAAGGTAGTATGGAGG - Intronic
940016108 2:149106835-149106857 GAGAGTAAAAAAAAGAGGGGAGG - Intronic
940462786 2:153988353-153988375 GGAAGTAGAAAGTAGAATGGTGG - Intronic
940801080 2:158133328-158133350 GGAAGTAGAGAGTAGAATGGTGG + Intronic
940844683 2:158627311-158627333 GAGAGTAGAGAGGAGACTGGAGG + Intronic
941134833 2:161701756-161701778 GGGGGTAGAGAGTAGAATGGTGG - Intronic
941152557 2:161932903-161932925 GGAAATAGAAAGTAGAATGGTGG - Intronic
941388930 2:164887910-164887932 TAAAGTCAAGAGTAGAATGGTGG - Intergenic
941523383 2:166577101-166577123 GAGAATAGAAAGTAGATTGGTGG - Intergenic
941712846 2:168732586-168732608 GTGAGAAAATAATAGAATGGAGG - Intronic
941915119 2:170807086-170807108 CAAAGCAAAAAGTAGAATGGTGG - Intergenic
942336695 2:174895385-174895407 GCAAACAAAAAGTAGAATGGTGG + Intronic
942681069 2:178478973-178478995 GAGCGTAAAAAATAGGCTGGCGG + Intergenic
942841101 2:180361516-180361538 GGAAGTAGAAAGTAGAATAGTGG + Intergenic
943165603 2:184321257-184321279 GAGACAGAAAAGTAGAATGGTGG + Intergenic
943257381 2:185613004-185613026 GGAAGCAGAAAGTAGAATGGTGG - Intergenic
943318722 2:186419669-186419691 AGGGGTAGAAAGTAGAATGGTGG + Intergenic
943487162 2:188500496-188500518 GAGAGTAAAAAGAAAATTGTAGG + Intronic
943558043 2:189428913-189428935 AAAAATAGAAAGTAGAATGGTGG + Intergenic
943908549 2:193532519-193532541 GAGAGGAAAAAGTAGAAGTCAGG + Intergenic
943922915 2:193732404-193732426 GAAAGTAAAGAGTAGATTGATGG + Intergenic
944068611 2:195645616-195645638 GAGACAAGAAAGTAGAATAGAGG - Intronic
944347160 2:198683242-198683264 AAGACCAGAAAGTAGAATGGCGG + Intergenic
944638599 2:201698820-201698842 GAGAGAAAATACTAGAATGTAGG - Intergenic
944687192 2:202127988-202128010 GATAACAGAAAGTAGAATGGTGG - Intronic
945183281 2:207113583-207113605 CAGAATACAAAGTGGAATGGGGG + Intronic
945339561 2:208635822-208635844 GAGATTAAAAAGTAGAATGGTGG + Intronic
946906737 2:224424595-224424617 AAAAGTAAAGAGTAGAATTGTGG + Intergenic
946936289 2:224724423-224724445 GAAAGTAAAGAGTACAATGATGG - Intergenic
946983417 2:225245073-225245095 GAGATTAAAAAGTAGCCTGCTGG + Intergenic
947251272 2:228107269-228107291 AAAAGTAGAGAGTAGAATGGTGG - Intronic
947269399 2:228317203-228317225 CACAGTAAAAAGAGGAATGGAGG - Intergenic
947450710 2:230205976-230205998 TTGACTAATAAGTAGAATGGGGG + Intronic
947477346 2:230462175-230462197 GAAAGAAAAAAATAGAATGAGGG + Intronic
947762891 2:232616642-232616664 GAGAGACAGAAGTAGAATGGTGG + Intronic
947977002 2:234375516-234375538 GAGAATAAAAAATAAAATGATGG - Intergenic
1169515136 20:6308645-6308667 TAGAGTAGAAAGTAGAATGGTGG - Intergenic
1169795329 20:9456375-9456397 GATGGTAAAAAGATGAATGGGGG + Intronic
1170392592 20:15891495-15891517 GAGAGTAAAGAGTAGAAGCAGGG + Intronic
1170962420 20:21037298-21037320 GACAGTAAAAGGTAGAAGGGGGG + Intergenic
1171565115 20:26176017-26176039 TATAGTAAAAAGAAAAATGGTGG + Intergenic
1171724920 20:28607702-28607724 GATAGCAAAAAGAAGAATGGAGG + Intergenic
1171753153 20:29075349-29075371 GATAGCAAAAAGAAGAATGGAGG - Intergenic
1171789110 20:29502209-29502231 GATAGCAAAAAGAAGAAGGGAGG + Intergenic
1171858420 20:30372291-30372313 GATAGCAAAAAGAAGAATGGAGG - Intergenic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1172729954 20:37078725-37078747 AGGAAGAAAAAGTAGAATGGTGG + Intronic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1174317980 20:49717433-49717455 GAGATGAAAAAGTAGTGTGGAGG - Intergenic
1176155526 20:63618186-63618208 CAAAGGAAAAAGGAGAATGGAGG + Intronic
1176327320 21:5511613-5511635 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176400437 21:6309338-6309360 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1176436720 21:6679766-6679788 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176460982 21:7006836-7006858 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176484543 21:7388614-7388636 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176804982 21:13472328-13472350 AGGAGTAGAGAGTAGAATGGTGG + Intergenic
1176858458 21:13987973-13987995 GAGACAAAAAACTAGAATAGTGG - Intergenic
1177390660 21:20465875-20465897 AGAAGTAAAAAGTAGAACGGTGG - Intergenic
1177934368 21:27324151-27324173 GAGTATAATAAGTACAATGGAGG - Intergenic
1178130458 21:29566005-29566027 TAGATAAAAAAGTAGAATGTTGG + Intronic
1178940319 21:36900179-36900201 GAGAGTAACACGTACAAAGGAGG + Intronic
1180298470 22:10966394-10966416 GATAGCAAAAAGAAGAATGGAGG + Intergenic
1180409942 22:12597412-12597434 GATAGCAAAAAGAAGAATGGAGG - Intergenic
1182640703 22:31764742-31764764 GAGAGAAAAAGGGAGAAGGGAGG - Intronic
1182963492 22:34499431-34499453 AAAAGTAGAAAGTAGAATGGTGG + Intergenic
1184429949 22:44436783-44436805 TAGAGACAGAAGTAGAATGGTGG - Intergenic
1184811949 22:46841647-46841669 GGAAGTAGAGAGTAGAATGGTGG + Intronic
949153786 3:803381-803403 CAGATTAAAAAGTAGTATGTTGG - Intergenic
949192297 3:1264893-1264915 GTAAGTAGAGAGTAGAATGGTGG - Intronic
949200130 3:1367333-1367355 CATAGTAAAGAGTAGCATGGTGG - Intronic
949309034 3:2674912-2674934 GAAAGTAGAGAGTAGAATAGAGG - Intronic
949843322 3:8343925-8343947 AGAAGTAAAAAGTAGAATAGCGG - Intergenic
950341585 3:12250858-12250880 AATAGTAGAATGTAGAATGGTGG + Intergenic
950560775 3:13721248-13721270 GAAAACAAAAAGTAAAATGGTGG - Intergenic
951285112 3:20801381-20801403 AGAAGTAAAAAGTAGAATAGAGG + Intergenic
951435703 3:22661223-22661245 AACAGTAAAAAGTTGAGTGGTGG + Intergenic
952196056 3:31076258-31076280 GAGCGTGAAAAGCAGGATGGTGG + Intergenic
952687248 3:36163892-36163914 GAATGGGAAAAGTAGAATGGAGG + Intergenic
953857640 3:46512535-46512557 GAAACAGAAAAGTAGAATGGTGG - Intergenic
955517490 3:59742003-59742025 TAGAGGAAAAAGTAGAAAAGAGG - Intergenic
956069694 3:65434813-65434835 GAGACTACACAGTAGAAGGGTGG + Intronic
956148111 3:66212669-66212691 TAGAGATAAAAGTAGCATGGTGG - Intronic
956175151 3:66465889-66465911 TAGAGACAGAAGTAGAATGGTGG - Intronic
956465541 3:69517293-69517315 CAGAGGAAAAAGTGGAATGAAGG - Intronic
956514028 3:70026368-70026390 CAGAGGAAAAAGTAGAAAGAAGG - Intergenic
957347211 3:78977335-78977357 GAGAGTAAAAAGGAGAGTAATGG - Intronic
957650636 3:82998089-82998111 AAGAAAAAAGAGTAGAATGGTGG + Intergenic
957877194 3:86162826-86162848 GGAAGTAGAAAGTAAAATGGTGG - Intergenic
957959725 3:87233737-87233759 GAGATTATAAAGTAGGATGTGGG + Intronic
958073996 3:88652802-88652824 CAGAGTAATCAGTAGAAAGGGGG + Intergenic
958831126 3:99090905-99090927 AGAAGTAGAAAGTAGAATGGTGG + Intergenic
958961613 3:100515803-100515825 GAAAGTAGAGAGTAGAATGGTGG + Intronic
958992709 3:100865756-100865778 AAGAGAAAAAAGTATAATTGGGG + Intronic
960636523 3:119790114-119790136 GGAAGCAGAAAGTAGAATGGTGG - Intronic
960659895 3:120046040-120046062 GATAGTAAAAAGTTCAGTGGTGG + Intronic
960865835 3:122199690-122199712 AGAAGTAAAAAGTAGAATAGTGG + Intronic
961090343 3:124105781-124105803 GAAAGGTAAAAATAGAATGGTGG + Intronic
961412372 3:126731739-126731761 GAGAGTAAATCTTAGAATGTGGG - Intronic
961953681 3:130777253-130777275 TAAAGTAAAAAGTAGAAAAGTGG + Intergenic
962050645 3:131810989-131811011 TAGAGCAGAGAGTAGAATGGTGG + Intronic
962276170 3:134015398-134015420 AGAAGTAAAAAGTAGAATGATGG + Intronic
963287848 3:143453754-143453776 TACTGTAGAAAGTAGAATGGGGG - Intronic
963550671 3:146718065-146718087 AAGAGTAAAATGTAAAATGGTGG - Intergenic
963579194 3:147102796-147102818 AGGAGCAAAGAGTAGAATGGTGG - Intergenic
964016930 3:151959145-151959167 TAGAATAAAGAGTAGAAAGGAGG + Intergenic
965026612 3:163310370-163310392 GGAAATAAAAAGTAGAAGGGTGG + Intergenic
965075639 3:163971552-163971574 GAGACTAAACAGTAGTTTGGTGG - Intergenic
965107978 3:164382940-164382962 TGGAGTAAAAAGAAAAATGGGGG + Intergenic
965121925 3:164570603-164570625 GAAGGTAACAAATAGAATGGTGG + Intergenic
965540130 3:169863619-169863641 GAGAGTGAAAGGTTAAATGGTGG - Intronic
966293653 3:178390894-178390916 GGAGGTAGAAAGTAGAATGGTGG + Intergenic
966311527 3:178599790-178599812 GAAAGAGAAAAGTAGAATGGTGG - Intronic
966844098 3:184113083-184113105 GAGAGTGGAAAGAAGAATGATGG - Intergenic
967226915 3:187300935-187300957 AGAAGTAAAGAGTAGAATGGTGG - Intergenic
968034195 3:195531888-195531910 TAGAGATAGAAGTAGAATGGTGG - Intronic
968400665 4:293492-293514 AAAAGCAGAAAGTAGAATGGTGG + Intronic
968744242 4:2351298-2351320 GAGAGTAGAGAGTAGAAAGTAGG + Intronic
969067532 4:4499360-4499382 GAAATTATAAAGTGGAATGGAGG + Intronic
969371860 4:6736606-6736628 AAAGATAAAAAGTAGAATGGTGG - Intergenic
969464192 4:7344963-7344985 GCGAGTCAAAAGCAGACTGGAGG - Intronic
969525310 4:7701233-7701255 GAGAGAAAAAAGGAGAGAGGAGG + Intronic
969554702 4:7898466-7898488 GAGAGTGGAAGGTAGAATGCAGG - Intronic
969582768 4:8075251-8075273 GAAAGTAGAAAGTAGAATGGTGG + Intronic
969748915 4:9095518-9095540 GGGAGAAGAAAGGAGAATGGAGG - Intergenic
970102310 4:12538599-12538621 GACAGGAAAAAGTATAAAGGTGG - Intergenic
970171299 4:13293257-13293279 GAAAGTAAAGAGTAAAAGGGGGG + Intergenic
970501672 4:16683676-16683698 GATAGATAAAAGTAGAATGATGG + Intronic
971034454 4:22677822-22677844 GGAAGTAAAAAGTAGAACAGAGG - Intergenic
971188398 4:24403142-24403164 GAGAGGAAAAAGTAGGATTTGGG - Intergenic
971468453 4:26991387-26991409 GGAAGTAGAGAGTAGAATGGTGG + Intronic
971703049 4:30005712-30005734 GAGAAAAAAAAGAAGAATGTTGG - Intergenic
971774738 4:30947887-30947909 GGAAGTAAAAAGTAGAACAGAGG - Intronic
971821817 4:31566848-31566870 GAAGGTAAAGAATAGAATGGTGG + Intergenic
971845029 4:31907215-31907237 AATAGTAAAAAGTAGAGTTGGGG + Intergenic
971846663 4:31927557-31927579 GAGTGTAAAAAGTAGATTTTGGG - Intergenic
971891641 4:32530967-32530989 AAGAACAAAAAGTAAAATGGTGG + Intergenic
972065005 4:34931123-34931145 TAGAGAAAAGAGTAGAATGGTGG + Intergenic
972774991 4:42232173-42232195 GAGAGGAAAAAGGAGAGAGGAGG + Intergenic
972844998 4:42976997-42977019 AAAAGTAGAGAGTAGAATGGTGG - Intronic
973030383 4:45330485-45330507 GGAAGCAGAAAGTAGAATGGTGG - Intergenic
973345737 4:49052967-49052989 GGAAGCAAAGAGTAGAATGGTGG - Intronic
973952749 4:56034246-56034268 AGAAGTAAAAAGTAGAATAGAGG - Intergenic
974369976 4:61003459-61003481 CAAAGCAGAAAGTAGAATGGTGG + Intergenic
974497092 4:62645875-62645897 AGAAGTAGAAAGTAGAATGGTGG - Intergenic
974596843 4:64024509-64024531 GAAAGCTAAAAGTAGAATTGGGG - Intergenic
974704307 4:65491992-65492014 GAGAATAAAATGGAGTATGGTGG + Intronic
974777398 4:66503336-66503358 AGAAGTAGAAAGTAGAATGGTGG + Intergenic
974861030 4:67521896-67521918 GACAGAAAAAAGTAGAATGGTGG + Intronic
974977516 4:68908348-68908370 AAGAAAAGAAAGTAGAATGGTGG - Intergenic
975162094 4:71135754-71135776 AAAAGCAAAAAGTAGAATGGTGG - Intergenic
975215640 4:71751135-71751157 GAGAGTAACAGGTAAAATGGAGG + Intronic
976025287 4:80680787-80680809 GAGAGTGTATAGTAGACTGGTGG - Intronic
976212279 4:82683129-82683151 GAGAGAAAACAGGAGCATGGCGG + Intronic
976366891 4:84242719-84242741 AGAAGTAGAAAGTAGAATGGTGG + Intergenic
976470269 4:85420170-85420192 GAGAGTACAAAGTATAATGGAGG + Intergenic
976548152 4:86361844-86361866 AAAACTAGAAAGTAGAATGGTGG + Intronic
976940247 4:90691843-90691865 GAGGGTGGAAGGTAGAATGGGGG - Intronic
976961047 4:90974020-90974042 AAAAGCAGAAAGTAGAATGGTGG + Intronic
977109104 4:92928265-92928287 CAGAGTAAAAAGTAGAGGGCTGG + Intronic
977201241 4:94119408-94119430 GAGAGTATAAAATAAAAGGGGGG + Intergenic
977967948 4:103177417-103177439 AAGAGTCAAGAGAAGAATGGTGG - Intronic
978776357 4:112510169-112510191 GAGAATAATAAGAAGCATGGGGG + Intergenic
979003211 4:115253937-115253959 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
979365724 4:119820785-119820807 GGAAATAAAAAATAGAATGGTGG - Intergenic
979542880 4:121906355-121906377 TAGAGTTAAAAGGAAAATGGGGG + Intronic
979648296 4:123098547-123098569 AAAAGCAGAAAGTAGAATGGTGG - Intronic
979768238 4:124489540-124489562 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
979884302 4:126005275-126005297 GAGAGTTAAAAAGAGAATGGGGG - Intergenic
980124296 4:128758978-128759000 CAGAGAAAGAAATAGAATGGAGG + Intergenic
980212554 4:129808565-129808587 GAAAGGAAAAAGTTGAATGGAGG + Intergenic
980246694 4:130254571-130254593 GAGAGAAAAAAGTACAGTTGGGG + Intergenic
980525377 4:133984857-133984879 GAGAAAAAAAAGTAGATTTGAGG + Intergenic
980631764 4:135445984-135446006 AAAAGCAGAAAGTAGAATGGTGG + Intergenic
980664796 4:135917554-135917576 GAAATTAAAAAGTAGAACAGAGG + Intergenic
980704041 4:136469350-136469372 GAGGATAAAGAGTAGATTGGTGG - Intergenic
981721045 4:147801671-147801693 GAGAGTAAAGAATATAATGAAGG + Intronic
981791974 4:148548374-148548396 CACAGAAGAAAGTAGAATGGTGG + Intergenic
981881304 4:149616393-149616415 GAAAACAGAAAGTAGAATGGTGG + Intergenic
981956537 4:150481018-150481040 ATGAGTAAAAAGTAGAACAGTGG - Intronic
982064672 4:151643618-151643640 GGAAGTAAAGAGTAGAATGGTGG - Intronic
982649350 4:158067317-158067339 GAGATTAGAAATTAGAATTGAGG - Intergenic
982656858 4:158160916-158160938 AAAAGTAGAGAGTAGAATGGTGG + Intronic
982934387 4:161452863-161452885 AAGAGTAAAAAGTATAACTGAGG - Intronic
982973081 4:162015750-162015772 TAAAGAAAAAAGTAGAAAGGAGG - Intronic
983100269 4:163617206-163617228 GGGAGTAGAAATTAGAATTGTGG + Intronic
983392727 4:167154001-167154023 GAGAGCAAAAACTAGTATTGGGG - Intronic
983744040 4:171172266-171172288 GGTAACAAAAAGTAGAATGGTGG - Intergenic
983832522 4:172345921-172345943 GAGAATAAATAGTCGTATGGTGG - Intronic
984041651 4:174742615-174742637 GAGAGTAAAAAGAAGATAGATGG + Intronic
984213297 4:176877119-176877141 GAGAGGAAAAAGTAGAATTAAGG + Intergenic
984724483 4:183007752-183007774 TAGACACAAAAGTAGAATGGGGG + Intergenic
985436554 4:189936008-189936030 GATAGCAAAAAGAAAAATGGAGG - Intergenic
985847423 5:2360830-2360852 GTAAGTAGAGAGTAGAATGGTGG - Intergenic
985992146 5:3572097-3572119 GCAAGTAGAGAGTAGAATGGTGG + Intergenic
986365420 5:7023735-7023757 AAAAGCAAAGAGTAGAATGGTGG - Intergenic
986392091 5:7296659-7296681 CTGAGACAAAAGTAGAATGGTGG - Intergenic
986926674 5:12762418-12762440 GGAAGTAGAGAGTAGAATGGTGG - Intergenic
987269209 5:16287917-16287939 GAGACTAAAAAGGAAAGTGGAGG + Intergenic
987689618 5:21250124-21250146 GAGAATAGAAAGTAGAAAGATGG - Intergenic
987910127 5:24132341-24132363 GAGAGAAGAAAGAAGAAAGGAGG + Intronic
988073979 5:26327951-26327973 GAGAGTAGAATGAAGAATGGAGG - Intergenic
988124389 5:27010255-27010277 AACAGCACAAAGTAGAATGGGGG - Intronic
988596516 5:32597264-32597286 AGGAACAAAAAGTAGAATGGTGG - Intronic
988978538 5:36540367-36540389 GGGAGTAGAGAGTAAAATGGTGG - Intergenic
990596332 5:57315969-57315991 GAGAGATAAGAATAGAATGGTGG - Intergenic
990652450 5:57917447-57917469 AAAAGTAAAAAGTAGAACAGAGG - Intergenic
991456419 5:66809098-66809120 GAAAGAAAAATGTAGAATGCAGG - Intronic
991472642 5:66985342-66985364 GTGAGTAGAAGGTAGAATGCAGG + Intronic
991931631 5:71758515-71758537 GGAAGTAGAGAGTAGAATGGTGG - Intergenic
992241009 5:74769712-74769734 TTGGTTAAAAAGTAGAATGGTGG + Intronic
992342350 5:75837662-75837684 AAAAATAGAAAGTAGAATGGTGG - Intergenic
993259199 5:85637693-85637715 AAAAGTAAAGAGTAGAATTGTGG + Intergenic
993304289 5:86255618-86255640 GAGAGTAAGAAGTGCACTGGGGG + Intergenic
993429113 5:87809952-87809974 GAAGGTAAAGAGTAGATTGGTGG - Intergenic
993822239 5:92632727-92632749 GTAAGTAGAAAGTAGAATGGTGG - Intergenic
994113490 5:96035603-96035625 GAGTGTAAAGAGTGGAATGGGGG + Intergenic
994250706 5:97533526-97533548 GAGAGTGAAATGAATAATGGAGG - Intergenic
994572561 5:101532906-101532928 GAGAACAAAAAGAAGAAAGGTGG - Intergenic
996551251 5:124732783-124732805 GGGAGTAAAAAGTAGAAGAAAGG - Intronic
996714921 5:126579400-126579422 GGGAGTAAACGGTAGGATGGTGG - Intronic
997730181 5:136165593-136165615 GAGATTAGAAAGCAGAGTGGTGG - Intronic
997850101 5:137324579-137324601 AAAAACAAAAAGTAGAATGGTGG + Intronic
998699370 5:144680306-144680328 GGAAGTAAAGAGTAGAATAGAGG + Intergenic
999054295 5:148557232-148557254 GGTAGTTAAAAGTAGCATGGTGG + Intronic
999181643 5:149674060-149674082 AAAAAAAAAAAGTAGAATGGCGG + Intergenic
999513202 5:152274260-152274282 AAAAGTAGAGAGTAGAATGGTGG - Intergenic
999625382 5:153515436-153515458 AGAAGTAAAGAGTAGAATGGTGG + Intronic
999695794 5:154188057-154188079 AAAAGGATAAAGTAGAATGGTGG + Intronic
999794569 5:154977009-154977031 CAGAGACAGAAGTAGAATGGTGG - Intergenic
1000013499 5:157256540-157256562 GAAAGTCAAAAGCAGATTGGAGG + Intergenic
1000447016 5:161334396-161334418 GAGAAAAAAACGTAGAAGGGAGG + Intronic
1001519981 5:172384539-172384561 TAGAGACAGAAGTAGAATGGTGG - Intronic
1001621918 5:173093944-173093966 GAGAGTAAAAAGTAGAATGGAGG - Intronic
1003263224 6:4543129-4543151 TAGAATAGAGAGTAGAATGGTGG + Intergenic
1004320167 6:14625902-14625924 GAGAGGAAGAAGGAGAAGGGAGG + Intergenic
1004676553 6:17848432-17848454 GGAAGTAGAAAGTAGAATAGTGG - Intronic
1004706138 6:18125436-18125458 GAGCTTAAAAATTAGAGTGGTGG - Intergenic
1005192804 6:23244957-23244979 GTGGGTAAAAAGTAGACTGAGGG + Intergenic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1005830449 6:29666902-29666924 GAGAGGAGAAAGTAGCAAGGAGG + Intronic
1005963419 6:30709693-30709715 GGAAGTAGAGAGTAGAATGGTGG - Intronic
1007456745 6:41983978-41984000 GGGAGTAGAGAGTGGAATGGTGG - Intronic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1008372064 6:50744189-50744211 GAGGGTAAAAAGTAGGAGGGTGG - Intronic
1008560366 6:52718745-52718767 TTGAGTAGAAAGCAGAATGGAGG - Intergenic
1008699684 6:54084120-54084142 AAGAGGAAAAAGTAGAACTGTGG - Intronic
1009042213 6:58191979-58192001 GATATTATAAAGTAGGATGGTGG + Intergenic
1009668550 6:66714921-66714943 GAAAGTGGAAAGTAGAATGATGG + Intergenic
1010081064 6:71863224-71863246 AAAAGTAAAGAGTAGGATGGTGG - Intergenic
1010321362 6:74514094-74514116 AAAAGTAGAAAGTAGAATGGTGG + Intergenic
1010321417 6:74514774-74514796 AAAAGTAGAAAGTAGAATGGTGG + Intergenic
1010480125 6:76341293-76341315 AGAAGTAGAAAGTAGAATGGTGG + Intergenic
1010851024 6:80777971-80777993 GAAAGTAAAAAGTGGAACAGAGG - Intergenic
1011027565 6:82886060-82886082 GAAAGTAAAATTAAGAATGGAGG - Intergenic
1011059289 6:83245224-83245246 GAGGGAAGAAAATAGAATGGAGG + Intronic
1011248628 6:85346617-85346639 GAGACAAAAAAGTAGAATGATGG + Intergenic
1011261242 6:85471995-85472017 GAGAGAAAAAAAGAGAGTGGTGG - Intronic
1011994965 6:93574878-93574900 GAGTTTGGAAAGTAGAATGGGGG - Intergenic
1012092770 6:94919541-94919563 GAGAGGAAAAAATAGTATGTGGG - Intergenic
1012257568 6:97051279-97051301 GAGAGTTGGAAGGAGAATGGAGG - Intronic
1012311685 6:97733200-97733222 GAGAGAAAAAAGTAGAATGAAGG + Intergenic
1012532285 6:100252175-100252197 GAGAGGAAGAAGTAGATCGGAGG + Intergenic
1012627875 6:101426506-101426528 GGGAGTAACAAATAGAATGGTGG - Intronic
1012733329 6:102909113-102909135 AGAAGTAAAGAGTAGAATGGTGG - Intergenic
1012777680 6:103519015-103519037 GAGAGAAAAAATTACAAAGGAGG - Intergenic
1012976251 6:105784095-105784117 GAGAGCAAAAATAAGAAAGGTGG - Intergenic
1013037882 6:106404559-106404581 GAGAGTAAGAATTAGAAATGTGG + Intergenic
1013067569 6:106698698-106698720 AAAAATAAAAAGTAAAATGGGGG - Intergenic
1013141846 6:107344650-107344672 GAGAAGAGAAAGTAGAATGGGGG + Intronic
1013570027 6:111413287-111413309 GGGGGAAAAAAGTAGAATGGAGG + Intronic
1013623434 6:111913137-111913159 GAGACCAGAAAATAGAATGGTGG - Intergenic
1013641826 6:112091041-112091063 AAAAGTAGAGAGTAGAATGGTGG - Intronic
1013730704 6:113162838-113162860 GAAGATAAAGAGTAGAATGGTGG + Intergenic
1014703798 6:124722005-124722027 TGGAGGAGAAAGTAGAATGGTGG - Intronic
1014832605 6:126120699-126120721 GAGACTAAAAAGTTAGATGGAGG + Intergenic
1014976393 6:127890393-127890415 GAGGGAAGAGAGTAGAATGGTGG + Intronic
1015599578 6:134899434-134899456 GAGAATAGAAAGTAGAATTGTGG - Intergenic
1015668809 6:135664100-135664122 GGAAGTAAAAAGTAGAAGAGAGG + Intergenic
1016271831 6:142299422-142299444 AAGAGTAGAGAGTACAATGGTGG + Intergenic
1016447116 6:144145763-144145785 AAGAAAAAAAAGTAGAATGGTGG + Intergenic
1016828189 6:148407262-148407284 TACAGACAAAAGTAGAATGGTGG - Intronic
1017115351 6:150971061-150971083 CAAAGTAAAGAGTAGAATAGTGG + Intronic
1017509078 6:155096530-155096552 GAAAGTAGAGAGTAGATTGGTGG - Intronic
1017539979 6:155391125-155391147 GAAAGTAGAGAGTAGATTGGTGG + Intergenic
1017685946 6:156913970-156913992 GGGAGTGGAGAGTAGAATGGGGG - Intronic
1017685963 6:156914022-156914044 GGGAGTAGAGAGTGGAATGGGGG - Intronic
1018134915 6:160769732-160769754 AGAAGTAAAAAGTAGAACGGAGG + Intergenic
1018556166 6:165052560-165052582 GAAAGAAAAAAGCTGAATGGAGG - Intergenic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1020837617 7:13173668-13173690 AAAAGTAGAGAGTAGAATGGTGG - Intergenic
1020911874 7:14141533-14141555 GGAAGTAAAAAGTAGAACAGAGG - Intergenic
1021230131 7:18076318-18076340 CATAGCAAAGAGTAGAATGGTGG - Intergenic
1021367360 7:19796399-19796421 GAAAGTAGACAGTAGAATTGTGG - Intergenic
1022276203 7:28857342-28857364 AAAAGTAGAAAGTAGAACGGTGG + Intergenic
1024135584 7:46404490-46404512 GAAGGTAGAGAGTAGAATGGTGG + Intergenic
1024673671 7:51619168-51619190 GAAAGTAGAAAATAGATTGGTGG + Intergenic
1024794584 7:53005817-53005839 GAGAGTGAAAAGGAGAATTATGG + Intergenic
1024911928 7:54456331-54456353 GAGTGTGAAAAGGAGAATGTGGG + Intergenic
1025628877 7:63249643-63249665 CACAGTAAAATGTAAAATGGTGG + Intergenic
1025653386 7:63494451-63494473 CACAGTAAAATGTAAAATGGTGG - Intergenic
1026198393 7:68192953-68192975 GGAAATGAAAAGTAGAATGGGGG - Intergenic
1027158083 7:75782528-75782550 GGGAGAAAAAGGAAGAATGGAGG - Intronic
1027401800 7:77816752-77816774 AGAAGTAAAAAGTAGAATGGAGG - Intronic
1027443021 7:78240596-78240618 AGAAGTAGAAAGTAGAATGGTGG + Intronic
1027528131 7:79296687-79296709 CATAGTAGAGAGTAGAATGGTGG + Intronic
1027727956 7:81830916-81830938 GAAAGTAAAGAGTAGAGTGGTGG + Intergenic
1027801991 7:82765896-82765918 GAGAAAAAAAAGTAAAATGTAGG + Intronic
1027946599 7:84754085-84754107 GAGATGTAAGAGTAGAATGGTGG + Intergenic
1028195290 7:87899816-87899838 GATAACAAGAAGTAGAATGGTGG + Intronic
1028599237 7:92583271-92583293 TAGAAAAGAAAGTAGAATGGAGG + Intronic
1028791079 7:94853629-94853651 GAAAGTAAAAAGTAAAACAGAGG - Intergenic
1031264155 7:119563187-119563209 GAGAGTAAAATGTCTAGTGGTGG + Intergenic
1031436657 7:121740083-121740105 AAAAGTAGAGAGTAGAATGGTGG + Intergenic
1031595148 7:123641179-123641201 GGGAGCAGAAAGTAAAATGGTGG + Intergenic
1031795045 7:126162562-126162584 GGAAGTAAAAAGTAGAACAGAGG + Intergenic
1032065689 7:128768512-128768534 GAAAGTTAAAAGTGGAAGGGTGG - Intronic
1032928886 7:136642156-136642178 GAGAATAGAAAGTAGAATTGTGG + Intergenic
1032957674 7:136990399-136990421 GACAGTAAAAAGATCAATGGTGG - Intronic
1033866907 7:145700272-145700294 TTAAGTAAAAAATAGAATGGTGG - Intergenic
1033939040 7:146628334-146628356 AAGAGTAGATAGTAGAATAGTGG + Intronic
1034031689 7:147773699-147773721 GAGAGTACAAAGAAGAAGGAAGG - Intronic
1034310522 7:150083786-150083808 GAGAGAAAACAGCAGTATGGAGG - Intergenic
1035228644 7:157447510-157447532 CAGAGACAGAAGTAGAATGGTGG - Intergenic
1036013385 8:4753483-4753505 GAAATGAAAAAGAAGAATGGAGG - Intronic
1036073511 8:5468940-5468962 GGAAGTAGAGAGTAGAATGGTGG + Intergenic
1036215667 8:6877825-6877847 GAGAGTAAACAGCAGAAGGTAGG + Exonic
1036762069 8:11516217-11516239 GAGAACAGAAAGTAGAACGGGGG + Intronic
1037512278 8:19595768-19595790 GGGAGTGAAAATTAGAGTGGAGG - Intronic
1037799113 8:22022665-22022687 GGGAGTAGAGAGTAGAATGATGG + Intergenic
1038135977 8:24786286-24786308 GAGACAAGAAAGTAGAATGATGG + Intergenic
1038183647 8:25252197-25252219 GAAAGAAACAAGTAGAAAGGAGG - Intronic
1038249490 8:25889879-25889901 TAAAGTAAAAAGGAGAAAGGGGG + Intronic
1038384152 8:27125487-27125509 GAAGGTAGAGAGTAGAATGGTGG - Intergenic
1038432153 8:27509056-27509078 TAGAGAAAAAAGCAGGATGGGGG - Intronic
1038437694 8:27547734-27547756 AGAAGTAAAAAGTAGAATGGAGG - Intergenic
1038576645 8:28710047-28710069 AAGAGTAAAAGGTAGAATGCTGG + Intronic
1038657152 8:29463564-29463586 GAGAGAGAAAAGTAGAGTAGAGG - Intergenic
1038985885 8:32809881-32809903 GAGAGTTAAAAGGAGAAAGATGG + Intergenic
1039022577 8:33223966-33223988 GAGAGTGATAAGTATAATGTAGG + Intergenic
1039367617 8:36947664-36947686 GGAAGTAAAGAGTAGAATAGAGG + Intergenic
1039435245 8:37555632-37555654 GAGAGTAAAAAGTACAAGTCAGG + Intergenic
1039519750 8:38160240-38160262 TAGAATAAAAAATAGAATGCAGG - Intergenic
1039651376 8:39342602-39342624 CAAAGTAGAGAGTAGAATGGTGG + Intergenic
1040642909 8:49361076-49361098 GACAGTAGAGAGTAGATTGGTGG - Intergenic
1040963018 8:53054626-53054648 AAAAGCAGAAAGTAGAATGGTGG - Intergenic
1041204855 8:55488637-55488659 GAGAATAAAAAGACCAATGGTGG + Intronic
1041283927 8:56240895-56240917 GGAAGTAAAAAGTAGAACAGAGG + Intergenic
1041332690 8:56744742-56744764 AAAAGTAAAAAGTTGAGTGGTGG + Intergenic
1041447440 8:57967629-57967651 GTGACTAAGAAGAAGAATGGGGG + Intergenic
1041472012 8:58221074-58221096 GAGAATAAAAAGAAAAATGATGG - Intergenic
1041622160 8:59984122-59984144 AGAAGTAGAAAGTAGAATGGTGG - Intergenic
1042223452 8:66495940-66495962 TAGGACAAAAAGTAGAATGGTGG - Intronic
1043123161 8:76357025-76357047 GAGAATAAAAAGGAGCACGGAGG + Intergenic
1043612954 8:82088814-82088836 GAAAGTAAAAAGTAAAAGGCAGG + Intergenic
1043636762 8:82393977-82393999 GAAAATACAAAGTAGAATGATGG - Intergenic
1043683486 8:83060759-83060781 TAGAGATTAAAGTAGAATGGTGG - Intergenic
1044042016 8:87381807-87381829 AGGATTAAAAAGTGGAATGGTGG + Intronic
1044128806 8:88494199-88494221 GAAAGTGAAAAACAGAATGGTGG + Intergenic
1044129353 8:88501471-88501493 TAGATTTAAAAGTAAAATGGTGG - Intergenic
1044381292 8:91536976-91536998 AAAAGTAGAGAGTAGAATGGTGG - Intergenic
1044649927 8:94483537-94483559 GAGACCGAAAAGGAGAATGGCGG + Intergenic
1044759507 8:95503142-95503164 GAGGGAAGAAAGGAGAATGGAGG - Intergenic
1044769332 8:95613539-95613561 TAGAGAAAAAAGTACAATGCTGG - Intergenic
1044837578 8:96311319-96311341 GAGAGTATAAAGAAAAATTGAGG + Intronic
1044925018 8:97202207-97202229 GGGAGTAGAAAGAGGAATGGAGG - Intergenic
1044998113 8:97856244-97856266 TAGAGTAAAAAATAGGAAGGGGG - Intergenic
1045044121 8:98258194-98258216 GAAGATAGAAAGTAGAATGGTGG + Intronic
1045760175 8:105596425-105596447 CAGGGTAAAAACTAGGATGGTGG - Intronic
1045805867 8:106160765-106160787 GAGGGTAAGATGTAGTATGGGGG - Intergenic
1046046950 8:108975975-108975997 GAGAGATAAGAGTAGAATCGTGG + Intergenic
1046125767 8:109905306-109905328 AGAAGTAAAGAGTAGAATGGTGG + Intergenic
1046170911 8:110504391-110504413 GAAAACAAAAAGCAGAATGGTGG - Intergenic
1046350621 8:113006341-113006363 CAGAGTTAAAAGAAGACTGGTGG + Intronic
1046601757 8:116325346-116325368 GACAGTGAAAAGCAAAATGGAGG + Intergenic
1047483215 8:125304554-125304576 GAGCTTTAAAAGTAGAATTGAGG + Intronic
1048539779 8:135332324-135332346 GAGAGAACAATGTAGCATGGGGG - Intergenic
1049226102 8:141451255-141451277 GAGAGAAAAAAGCAGCGTGGGGG + Intergenic
1049461559 8:142731787-142731809 AAAAGTAAAAAGGGGAATGGTGG - Intronic
1050898996 9:10920872-10920894 GGAAGCAAAAAGTAAAATGGTGG + Intergenic
1051274690 9:15387475-15387497 TAGAGGAAAATGTAGAATGAAGG + Intergenic
1051306179 9:15712342-15712364 TAGAAAAGAAAGTAGAATGGAGG - Intronic
1051791790 9:20813049-20813071 TAGAGCAGAAAGTAGAATGGTGG - Intronic
1051828510 9:21249231-21249253 AAAAGTAAAAAGTAGAACAGAGG + Intergenic
1051894319 9:21972035-21972057 AGCAGTAAAGAGTAGAATGGTGG - Intronic
1051989365 9:23132937-23132959 GAAAGTGAAAAACAGAATGGTGG + Intergenic
1051993830 9:23189002-23189024 CAAAGTAAAAAGTAAGATGGGGG - Intergenic
1052045733 9:23792085-23792107 GACAGTGAAAAATAGAATGATGG - Intronic
1052102489 9:24465996-24466018 GAGAGTAAGAAATTGAATAGAGG + Intergenic
1052777286 9:32744904-32744926 TAGAGTAGAGAGCAGAATGGTGG + Intergenic
1053039795 9:34860560-34860582 GAGAGAAAAAAATAGAAGGAAGG - Intergenic
1053083237 9:35194935-35194957 GAGAGCAAAAGGTGGACTGGCGG + Intronic
1053724681 9:40987479-40987501 GATAGCAAAAAGAAGAATGGAGG - Intergenic
1054341289 9:63864520-63864542 GATAGCAAAAAGAAGAATGGAGG + Intergenic
1055274081 9:74594569-74594591 GAGAGAAAAAAGCAGAAAGTTGG + Intronic
1055442350 9:76348827-76348849 AGAAGTAAAGAGTAGAATGGTGG - Intronic
1055756214 9:79560807-79560829 GAGAATTAAAAGTAAAAAGGTGG + Intergenic
1056090299 9:83198816-83198838 GAAAGTTATAAATAGAATGGGGG + Intergenic
1056881935 9:90402887-90402909 GCAAGTAGAGAGTAGAATGGTGG + Intergenic
1057876569 9:98759800-98759822 GTAAGTAAAAAGTAGAACAGAGG + Intronic
1058083549 9:100724357-100724379 AAAAGCAGAAAGTAGAATGGTGG - Intergenic
1058884200 9:109310996-109311018 TAGACAAAAAAGTAGAATGGTGG + Intronic
1058990439 9:110250543-110250565 CAGAGTGTAAAGTAGAATGTAGG + Intronic
1059009367 9:110439900-110439922 AAGAGTAAAAAGTAGATTGAAGG - Intronic
1059066780 9:111093845-111093867 GAGAGCAAAAAGTATAAGCGAGG - Intergenic
1059193659 9:112350218-112350240 GAGGGTAAAGGGTGGAATGGGGG + Intergenic
1060227792 9:121806038-121806060 GAAGATAAAAAGTAGAATGACGG + Intergenic
1060844336 9:126823679-126823701 AATAATAAAAAGTAGGATGGGGG - Intronic
1060997193 9:127881403-127881425 TAGAAAAAAAAGTAGAATGGTGG + Intergenic
1061928803 9:133821663-133821685 GAGACTAAAAAGTTGGATGGGGG + Intronic
1203434793 Un_GL000195v1:128893-128915 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1185513959 X:684545-684567 GGGTGTAAAAAGTAAAATAGAGG - Intergenic
1185957252 X:4504722-4504744 GGAAGTAGAGAGTAGAATGGTGG - Intergenic
1186396656 X:9215812-9215834 AGAGGTAAAAAGTAGAATGGTGG + Intergenic
1186479669 X:9886627-9886649 GAATGCAGAAAGTAGAATGGTGG - Intronic
1186649947 X:11548439-11548461 GGAAGTAAAGAGTAGAATTGTGG - Intronic
1186900979 X:14055686-14055708 AAGAGTAAAGAGTAGAACAGTGG - Intergenic
1187032277 X:15500233-15500255 CAGAGAAAATAGTGGAATGGGGG + Intronic
1187047621 X:15662959-15662981 GAGAGTAAAGATTAGAAAGAGGG - Intronic
1187124617 X:16443248-16443270 GGAAGTAGAAAGTAGAATGATGG + Intergenic
1187456859 X:19448919-19448941 GGGAAAAAAAAGTAGAATGGTGG - Intronic
1187576149 X:20558258-20558280 AGAAGTACAAAGTAGAATGGTGG - Intergenic
1188001048 X:24982187-24982209 CAGCATCAAAAGTAGAATGGTGG - Intronic
1188049503 X:25467203-25467225 AAAAGTAAAGAGTAGAATGGTGG - Intergenic
1188165229 X:26854396-26854418 CATTGTAAAAAGTAGAATGTTGG - Intergenic
1188251094 X:27895892-27895914 GAGACAAAAAAGTAGAATGGTGG - Intergenic
1188304646 X:28547267-28547289 AAGACTAGAAAGTAGAATAGAGG - Intergenic
1188385923 X:29557699-29557721 AAGAGCAGAAAGTAGAATGGAGG - Intronic
1188437970 X:30184596-30184618 GAGAATAATTAGTAGGATGGAGG + Intergenic
1188466100 X:30483066-30483088 GAAGGTAGAAAGTAGCATGGTGG + Intergenic
1188786852 X:34357141-34357163 GAGAGGGAAAAGGAGAAAGGAGG - Intergenic
1188816348 X:34719196-34719218 AAGAATAAAAAATAAAATGGTGG + Intergenic
1189120254 X:38386485-38386507 AAAAGGAGAAAGTAGAATGGTGG - Intronic
1189407433 X:40737330-40737352 AAAAGTAAAGAGTAGAATGGTGG - Intergenic
1189481186 X:41393536-41393558 GACAACAGAAAGTAGAATGGTGG + Intergenic
1189490142 X:41464869-41464891 GAAAATAAAAAGAAGACTGGGGG - Intronic
1189561752 X:42198196-42198218 AAAAGTAAAGAGTAGAATGGTGG - Intergenic
1189764734 X:44358967-44358989 AAAAGCAGAAAGTAGAATGGTGG + Intergenic
1190390628 X:49927966-49927988 GAAGGTAGAAAGTCGAATGGTGG + Intronic
1190505687 X:51124078-51124100 GTGAGTGAAAAATAGAAGGGTGG - Intergenic
1191036935 X:56035147-56035169 AAAAGTAAAAAGTAGAACAGAGG - Intergenic
1191084954 X:56556074-56556096 GAAAGTAGAGAGTAGAATAGAGG + Intergenic
1192986410 X:76404363-76404385 AAAAGTAGAAAGCAGAATGGTGG + Intergenic
1193558156 X:82982443-82982465 GAATGTAGACAGTAGAATGGTGG + Intergenic
1193750132 X:85331768-85331790 GCAAGTAGAAAGTAGAATAGTGG - Intronic
1193795026 X:85863513-85863535 AATAGTAACAAGTAGAATTGTGG - Exonic
1194224404 X:91238381-91238403 GGAAGTAGAGAGTAGAATGGTGG - Intergenic
1194332795 X:92604573-92604595 GAAAATAAAAAGAAAAATGGCGG + Intronic
1194453885 X:94079050-94079072 GGGGGTAAAGAGTAGAATAGTGG + Intergenic
1194636899 X:96356640-96356662 AGGAGTAGAAAGTAGAATGATGG + Intergenic
1194793328 X:98178503-98178525 GAGAATACAAAGTAGAATCATGG - Intergenic
1195086770 X:101420641-101420663 GAGAGTTAAAGGAAGAATAGTGG + Intronic
1195169888 X:102257011-102257033 GAGTGTTAAAAGGAGACTGGGGG - Intergenic
1195188969 X:102430089-102430111 GAGTGTTAAAAGGAGACTGGGGG + Intronic
1195208909 X:102632200-102632222 AGCAGTAGAAAGTAGAATGGTGG + Intergenic
1195529166 X:105932031-105932053 AAGAAAAAAAAGTAGAATAGAGG - Intronic
1195905357 X:109839120-109839142 TAGAGTTTAAAGTACAATGGGGG - Intergenic
1196099424 X:111832007-111832029 GAGAGTAATAAGGAGATTGAGGG + Intronic
1196318592 X:114260768-114260790 GAAAGTAGAAAGTAGAATAGTGG - Intergenic
1196371472 X:114984203-114984225 GAGAGGCAAAAGGGGAATGGAGG + Intergenic
1196550214 X:117015588-117015610 TAGAGACAAAAGTAGAATAGTGG + Intergenic
1196558032 X:117114276-117114298 TATAATAGAAAGTAGAATGGTGG + Intergenic
1196560139 X:117136519-117136541 GGAAGTAGTAAGTAGAATGGTGG - Intergenic
1196566299 X:117208903-117208925 GTAAGTAAAAAATAGAATTGTGG + Intergenic
1196570169 X:117256816-117256838 TTGAGTAAAAAGATGAATGGTGG + Intergenic
1196871152 X:120115028-120115050 GACATAAAATAGTAGAATGGTGG + Intronic
1197052842 X:122080878-122080900 GCTAGTAAAAAATACAATGGAGG + Intergenic
1197062867 X:122202160-122202182 AGAAGCAAAAAGTAGAATGGTGG + Intergenic
1197197817 X:123720869-123720891 AGAAGCAAAAAGTAGAATGGTGG + Intronic
1197952456 X:131912592-131912614 AGAAGTAGAAAGTAGAATGGGGG + Intergenic
1197962142 X:132018543-132018565 GAGAGTAAACAGTAAATTTGAGG + Intergenic
1198410788 X:136365311-136365333 GAGACAAAAAAGTAGATTAGTGG - Intronic
1198628787 X:138610997-138611019 GATAGTAAAAAGGAACATGGAGG - Intergenic
1198729193 X:139709101-139709123 AGAAGTAGAAAGTAGAATGGTGG - Intergenic
1198980052 X:142385256-142385278 GAGAGTGAAAAGGAAAATGGAGG + Intergenic
1199866860 X:151859398-151859420 AAAAGTAAAAAGTAGAATAGAGG + Intergenic
1200560866 Y:4701743-4701765 GGAAGTAGAGAGTAGAATGGTGG - Intergenic
1200943967 Y:8813387-8813409 AAGAGCAAAAGGTAGAATTGAGG - Intergenic
1202030549 Y:20569840-20569862 GGGAGAAAAAAATAGAATGAAGG + Intergenic
1202303759 Y:23445859-23445881 GAGAATAAAAAAAAGTATGGAGG + Intergenic
1202567051 Y:26224734-26224756 GAGAATAAAAAAAAGTATGGAGG - Intergenic