ID: 1001629025

View in Genome Browser
Species Human (GRCh38)
Location 5:173160747-173160769
Sequence TTGGCGAATCAGCTGCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001629021_1001629025 13 Left 1001629021 5:173160711-173160733 CCAGGCAAGTTTGGGAATGGTTG 0: 1
1: 0
2: 1
3: 16
4: 138
Right 1001629025 5:173160747-173160769 TTGGCGAATCAGCTGCTGGTAGG 0: 1
1: 0
2: 0
3: 1
4: 118
1001629018_1001629025 21 Left 1001629018 5:173160703-173160725 CCATATGGCCAGGCAAGTTTGGG 0: 1
1: 0
2: 1
3: 12
4: 111
Right 1001629025 5:173160747-173160769 TTGGCGAATCAGCTGCTGGTAGG 0: 1
1: 0
2: 0
3: 1
4: 118
1001629016_1001629025 22 Left 1001629016 5:173160702-173160724 CCCATATGGCCAGGCAAGTTTGG 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1001629025 5:173160747-173160769 TTGGCGAATCAGCTGCTGGTAGG 0: 1
1: 0
2: 0
3: 1
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001629025 Original CRISPR TTGGCGAATCAGCTGCTGGT AGG Intronic
900663238 1:3796475-3796497 ATGGCGCCTCAGCTGCTGGCAGG + Exonic
907934082 1:59026525-59026547 TGGGCAACTCAGCTGCGGGTGGG - Intergenic
908960418 1:69690905-69690927 TTGGTGACTCAGCTTCTTGTGGG + Intronic
912034372 1:105293062-105293084 TTGGCCAACCAGCTGATGTTTGG + Intergenic
912102116 1:106222604-106222626 TTGGTGAGTCACCTCCTGGTGGG - Intergenic
915535023 1:156530288-156530310 TCGGCTCATCAGCTGCTTGTGGG + Exonic
915657025 1:157369130-157369152 TTGGTGAGTCAGCTGCTCCTGGG + Intergenic
919505359 1:198391583-198391605 TTAGCAAATCCGCAGCTGGTGGG - Intergenic
924035383 1:239930814-239930836 TTGGTGAGTCAGCTTCTTGTGGG + Intergenic
924196466 1:241612774-241612796 TTGGTGAGTCAGCTTCTCGTGGG - Intronic
1064982578 10:21179395-21179417 TTGGTGAGTCAGCTTCTTGTGGG - Intergenic
1067031785 10:42882951-42882973 CTGGTGAGTCAGCTGCTTGTGGG + Intergenic
1068987506 10:63120830-63120852 TTGGTGAGTCAGCTTCTTGTTGG + Intergenic
1074096171 10:110314911-110314933 TGGGCGAATCACCTGCTGTCAGG - Intergenic
1077541780 11:3150092-3150114 CAGGGGAAACAGCTGCTGGTTGG - Intronic
1078967740 11:16366262-16366284 GTGTTTAATCAGCTGCTGGTTGG + Intronic
1083274030 11:61587010-61587032 TTGGCGAAAGAGCTTCTGCTTGG - Intergenic
1084206914 11:67600457-67600479 TTGGCCCCTCAGCTGCTGGGAGG - Intergenic
1086711053 11:90009843-90009865 TTGGCGAGTCAGTTGCTTCTGGG - Intergenic
1088332101 11:108664956-108664978 TTGGCGAATTGGCTCCTGCTGGG - Intergenic
1089128348 11:116193089-116193111 TTGGCGGATCAGAGGCTGGAGGG + Intergenic
1090680840 11:129056096-129056118 TCAGCTAATCAGCTGATGGTTGG + Intronic
1091391370 12:128326-128348 CTGGCGAAGAAGCTGCTGGAAGG + Intronic
1104153447 12:126107321-126107343 TGGGTGAAGCTGCTGCTGGTTGG + Intergenic
1111349796 13:87013171-87013193 TTGGAGGGTCAGCTGCTGGCAGG + Intergenic
1111668171 13:91295877-91295899 TCGGAGAATCAGCTGTTGGATGG + Intergenic
1112241565 13:97687028-97687050 TTGGCCAAAGAGCTGCAGGTGGG - Intergenic
1114379166 14:22182774-22182796 TTGGGGAATTATCTGCTGGCTGG - Intergenic
1118836161 14:69479450-69479472 TTAGGGAGTCAGCTGTTGGTGGG + Intergenic
1120584510 14:86295259-86295281 TTGGTGAATCAGCTCCTCCTGGG - Intergenic
1124160956 15:27269337-27269359 TTAGTGAATCAGGTGGTGGTGGG - Intronic
1125746917 15:42003619-42003641 TTTGCCAATCAGCTGTTGATGGG + Intronic
1128368268 15:67020273-67020295 CTTGGGACTCAGCTGCTGGTGGG - Intergenic
1129805199 15:78450565-78450587 TTGGGAAAACAGATGCTGGTAGG + Intronic
1129847780 15:78775912-78775934 ATGGCAAAGCAGCTGCTGGCTGG - Intronic
1130022310 15:80241748-80241770 TGGGGGAAACAGCTGCTCGTTGG + Intergenic
1130254123 15:82318003-82318025 GTGGCAAAGCAGCTGCTGGCTGG + Intergenic
1130600848 15:85271968-85271990 GTGGCAAAGCAGCTGCTGGCTGG - Intergenic
1131156033 15:90076166-90076188 CTGGCAAATCAGCTGCATGTTGG + Intronic
1132874533 16:2130462-2130484 TTGGAGAATCATCTGCGTGTTGG + Intronic
1133845993 16:9454415-9454437 TTGGTGAATCAGCTTCTCATGGG - Intergenic
1135295850 16:21278457-21278479 TTGGGGAATCCGTTGCTGGAAGG - Intronic
1136179756 16:28542955-28542977 TTGGGGAGTTAGCTCCTGGTGGG + Intergenic
1141890558 16:86924134-86924156 TGGGCGCATTTGCTGCTGGTGGG - Intergenic
1142787808 17:2237952-2237974 TTGGGGAAACAGCTCCAGGTTGG + Intronic
1145060197 17:19728363-19728385 CTGGAGAATCAGCGGCTGCTTGG + Intergenic
1145207859 17:20994299-20994321 GTGGTGGATCAGCTGCTGGACGG + Intergenic
1153139200 18:1953492-1953514 TTAGCCAATCACCTGTTGGTGGG + Intergenic
1155302850 18:24448140-24448162 ATGGGGAAACAGCAGCTGGTGGG + Exonic
1155339808 18:24802609-24802631 TTGGCCAGTCAGCAGCTGGGAGG + Intergenic
1159916660 18:74194124-74194146 TGGAGGAAGCAGCTGCTGGTAGG - Intergenic
1162566712 19:11448713-11448735 TTGGGGAACCATCTGCGGGTGGG + Intronic
926853656 2:17228563-17228585 CTGTGGAAGCAGCTGCTGGTTGG - Intergenic
929648818 2:43657163-43657185 TTGGCAAATCAGCTGGAGGGTGG + Intronic
935142861 2:100369249-100369271 TTGGTGAATCAGCTTCTTGTTGG + Intergenic
937236880 2:120436551-120436573 TTGGAGAACCAGCTGCTGCAGGG - Intergenic
938961362 2:136344572-136344594 TTGGCAAGTCAGCTGGTGGCTGG - Intergenic
940404713 2:153287575-153287597 TGGGCCATTCAGCTGCTGGCGGG + Intergenic
946401220 2:219469313-219469335 TTGTGGAACCAGCTGATGGTGGG - Exonic
947308840 2:228778179-228778201 TTGGTGAGTCAGCTTCTTGTGGG - Intergenic
1169880788 20:10343696-10343718 TTGTCAAGTCAGCTGCTGTTAGG - Intergenic
1170484985 20:16807088-16807110 TTGGTGAGTCAGCTCCTCGTGGG - Intergenic
1173800925 20:45893946-45893968 AAAGCGCATCAGCTGCTGGTGGG - Intronic
1175769629 20:61615491-61615513 TTGGCAAATAAGCTGCACGTGGG - Intronic
1181671991 22:24430011-24430033 CTGGCAAATCAGCTCCTGGCCGG - Intronic
1183341141 22:37282506-37282528 TTGCCGACCCAGCTGCTGTTCGG - Exonic
1183741170 22:39669463-39669485 TGGGCGAATAAGTGGCTGGTGGG + Intronic
1183983646 22:41557413-41557435 TTTGTTACTCAGCTGCTGGTGGG + Intergenic
949162792 3:900886-900908 CAGGCCAATCAGCTGCTTGTTGG - Intergenic
954556326 3:51520265-51520287 TGGGCCACTCAGCTACTGGTAGG + Intergenic
956086199 3:65613668-65613690 TTGGGGAATTAGCTGATGCTGGG + Intronic
956545401 3:70395640-70395662 CTGGCAAAGCAGCTACTGGTTGG + Intergenic
958984211 3:100761525-100761547 TTAGCAAAACAGCTGCTGGATGG + Intronic
959164395 3:102758785-102758807 TTGGCAAATCGGCCGCTGGATGG - Intergenic
960249546 3:115436996-115437018 TTGGGGAATCAGCAGCTAGATGG - Intergenic
961974071 3:131004259-131004281 TATGCAAATCAGCTGCTGTTTGG - Intronic
963795451 3:149626861-149626883 TTGGCCAAGCAGCTGCTTGGTGG - Intronic
968358035 3:198123328-198123350 TTGGCCACTCAGCAGCTGCTCGG + Intergenic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
975021573 4:69497233-69497255 TTGGTGAGTCAGCTCCTTGTGGG - Intronic
975341413 4:73245442-73245464 TTGTAGACTCAGCTGCTGTTTGG - Intronic
977909688 4:102518772-102518794 TTGGCTACTCAGCTGGTGCTAGG + Intronic
981335537 4:143565035-143565057 TTGGAGGAACAGGTGCTGGTTGG + Intergenic
983141481 4:164154978-164155000 TCGGAGAATTAGCTGCTGGATGG - Intronic
984555638 4:181211203-181211225 ATGGGGAAGCAGGTGCTGGTAGG + Intergenic
987271573 5:16314682-16314704 TTGGAGAATCAGCCACTGGATGG + Intergenic
988451521 5:31348787-31348809 TTGGCAAATCTGCTGCTTGCTGG - Intergenic
990085282 5:51968971-51968993 TTGGCAAATCAGCTCCTCATGGG + Intergenic
990119431 5:52431842-52431864 CTGGTGAATCAGCTTCTTGTGGG - Intergenic
991949991 5:71938434-71938456 TTACCGAAACAGCTGCTGTTTGG + Intergenic
993899383 5:93574017-93574039 TTTTCCAATTAGCTGCTGGTTGG - Intergenic
997838032 5:137212210-137212232 CTGGAGAATCAGGTGTTGGTGGG + Intronic
1001629025 5:173160747-173160769 TTGGCGAATCAGCTGCTGGTAGG + Intronic
1003770366 6:9292255-9292277 TTGTCTAATGTGCTGCTGGTGGG + Intergenic
1007698321 6:43747879-43747901 TTCACGTATCAGCTGCTGGGTGG - Intergenic
1010712260 6:79188990-79189012 TTGTGGAATCAGCTGCAGGATGG + Intergenic
1013778349 6:113703478-113703500 TGGGCGAATCAACTGATGTTGGG - Intergenic
1019187872 6:170231509-170231531 TTGGCCAACAGGCTGCTGGTTGG + Intergenic
1021224758 7:18014024-18014046 TTGGTGAGTCAGCTCCTTGTGGG + Intergenic
1026290615 7:69002539-69002561 TTGGTGAGTCAGCTCCTTGTGGG + Intergenic
1026556104 7:71409955-71409977 TTGGTGAGTCAGCTTCTTGTGGG + Intronic
1027455997 7:78392868-78392890 TTGGCGAATCACCTGAGGTTGGG - Intronic
1027781655 7:82527830-82527852 TTGGTGAGTCAGCTTCTTGTGGG + Intergenic
1034341302 7:150357970-150357992 GTGGTGAGTCACCTGCTGGTGGG - Intergenic
1036394975 8:8361761-8361783 TTGGCCAAACAACTGCTGGCTGG + Intronic
1038583528 8:28770225-28770247 TTAGCGAATAAGGTGTTGGTAGG - Intronic
1038713571 8:29971849-29971871 TTGGCCAATTGGATGCTGGTAGG + Intergenic
1045797179 8:106059956-106059978 TTGGTGAGTCAGCTTCTTGTGGG - Intergenic
1049239700 8:141530942-141530964 TGGACCAATCAGCTGCTGTTGGG + Intergenic
1051616978 9:19015870-19015892 TTGGTGATTCAGATGCAGGTGGG - Intronic
1052199489 9:25761129-25761151 TTGGCGAAAGAGCTGCGAGTTGG - Intergenic
1057307863 9:93922521-93922543 TTGCCGAATCAAATGCTGGAAGG + Intergenic
1057871764 9:98723357-98723379 TTGGGGATGCAGCTGCTGCTTGG + Intergenic
1060729684 9:126029507-126029529 TCGGAGCCTCAGCTGCTGGTAGG - Intergenic
1061485312 9:130917630-130917652 GTGGCAAAGCAGCAGCTGGTTGG - Intronic
1190302249 X:49063853-49063875 CTGGCCAGTCAGCTCCTGGTGGG - Exonic
1191085837 X:56565537-56565559 TTGCTGAATGAACTGCTGGTTGG - Exonic
1192324328 X:70119306-70119328 TTGGTGAGTCAGCTTCTTGTGGG + Intergenic
1194725411 X:97389904-97389926 TTGGTGAGTCAGCTTCTTGTGGG + Intronic
1198633343 X:138667782-138667804 ATGTTGAATCAGCTGCTGTTGGG - Intronic