ID: 1001637639

View in Genome Browser
Species Human (GRCh38)
Location 5:173223483-173223505
Sequence CAGTGCAAAGACTCTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001637636_1001637639 -5 Left 1001637636 5:173223465-173223487 CCAAGCAAAGGGAACAGCCAGTG No data
Right 1001637639 5:173223483-173223505 CAGTGCAAAGACTCTGAGGCAGG No data
1001637632_1001637639 24 Left 1001637632 5:173223436-173223458 CCAGGCAGACATTCTGGGGGAAG No data
Right 1001637639 5:173223483-173223505 CAGTGCAAAGACTCTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001637639 Original CRISPR CAGTGCAAAGACTCTGAGGC AGG Intergenic
No off target data available for this crispr