ID: 1001639275

View in Genome Browser
Species Human (GRCh38)
Location 5:173233817-173233839
Sequence ACAAATTCGGGCGGGCACGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001639275_1001639288 25 Left 1001639275 5:173233817-173233839 CCGCCGTGCCCGCCCGAATTTGT No data
Right 1001639288 5:173233865-173233887 CCTATGAATTCTCTCCCGGCTGG 0: 1
1: 0
2: 1
3: 0
4: 52
1001639275_1001639286 21 Left 1001639275 5:173233817-173233839 CCGCCGTGCCCGCCCGAATTTGT No data
Right 1001639286 5:173233861-173233883 CAAACCTATGAATTCTCTCCCGG 0: 1
1: 0
2: 1
3: 10
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001639275 Original CRISPR ACAAATTCGGGCGGGCACGG CGG (reversed) Intronic