ID: 1001644886

View in Genome Browser
Species Human (GRCh38)
Location 5:173272965-173272987
Sequence CTTTCTCCCATCACACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001644886_1001644893 24 Left 1001644886 5:173272965-173272987 CCAGCCTGTGTGATGGGAGAAAG No data
Right 1001644893 5:173273012-173273034 TCCTTTCCAGGAAGAGATGTGGG No data
1001644886_1001644889 -8 Left 1001644886 5:173272965-173272987 CCAGCCTGTGTGATGGGAGAAAG No data
Right 1001644889 5:173272980-173273002 GGAGAAAGAGAGATAGTTGAGGG No data
1001644886_1001644892 23 Left 1001644886 5:173272965-173272987 CCAGCCTGTGTGATGGGAGAAAG No data
Right 1001644892 5:173273011-173273033 TTCCTTTCCAGGAAGAGATGTGG No data
1001644886_1001644891 12 Left 1001644886 5:173272965-173272987 CCAGCCTGTGTGATGGGAGAAAG No data
Right 1001644891 5:173273000-173273022 GGGTAGGCAATTTCCTTTCCAGG No data
1001644886_1001644888 -9 Left 1001644886 5:173272965-173272987 CCAGCCTGTGTGATGGGAGAAAG No data
Right 1001644888 5:173272979-173273001 GGGAGAAAGAGAGATAGTTGAGG No data
1001644886_1001644890 -4 Left 1001644886 5:173272965-173272987 CCAGCCTGTGTGATGGGAGAAAG No data
Right 1001644890 5:173272984-173273006 AAAGAGAGATAGTTGAGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001644886 Original CRISPR CTTTCTCCCATCACACAGGC TGG (reversed) Intergenic
No off target data available for this crispr