ID: 1001645395

View in Genome Browser
Species Human (GRCh38)
Location 5:173277961-173277983
Sequence CTAACACAGAAGTTCCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001645395_1001645397 19 Left 1001645395 5:173277961-173277983 CCCTCAAGGAACTTCTGTGTTAG No data
Right 1001645397 5:173278003-173278025 AACAGACCATTGCAATCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001645395 Original CRISPR CTAACACAGAAGTTCCTTGA GGG (reversed) Intergenic
No off target data available for this crispr