ID: 1001648636

View in Genome Browser
Species Human (GRCh38)
Location 5:173299932-173299954
Sequence CTCCTTCTCACGGGCAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001648636_1001648648 30 Left 1001648636 5:173299932-173299954 CCAGGATTGCCCGTGAGAAGGAG No data
Right 1001648648 5:173299985-173300007 GCGGCATCTTAGAATGAAGCGGG No data
1001648636_1001648647 29 Left 1001648636 5:173299932-173299954 CCAGGATTGCCCGTGAGAAGGAG No data
Right 1001648647 5:173299984-173300006 CGCGGCATCTTAGAATGAAGCGG No data
1001648636_1001648644 11 Left 1001648636 5:173299932-173299954 CCAGGATTGCCCGTGAGAAGGAG No data
Right 1001648644 5:173299966-173299988 GCAGCCTCGGCAATGCCACGCGG No data
1001648636_1001648642 -2 Left 1001648636 5:173299932-173299954 CCAGGATTGCCCGTGAGAAGGAG No data
Right 1001648642 5:173299953-173299975 AGGCTGGGAGCCTGCAGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001648636 Original CRISPR CTCCTTCTCACGGGCAATCC TGG (reversed) Intergenic
No off target data available for this crispr