ID: 1001650688

View in Genome Browser
Species Human (GRCh38)
Location 5:173313941-173313963
Sequence CCTATTTTACACGAGGCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001650688_1001650695 29 Left 1001650688 5:173313941-173313963 CCCCAAGCCTCGTGTAAAATAGG No data
Right 1001650695 5:173313993-173314015 AAATTTAAAGTGGAGATTCTAGG No data
1001650688_1001650693 -8 Left 1001650688 5:173313941-173313963 CCCCAAGCCTCGTGTAAAATAGG No data
Right 1001650693 5:173313956-173313978 AAAATAGGCATAACACTGATTGG No data
1001650688_1001650694 19 Left 1001650688 5:173313941-173313963 CCCCAAGCCTCGTGTAAAATAGG No data
Right 1001650694 5:173313983-173314005 ACTTAAAAATAAATTTAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001650688 Original CRISPR CCTATTTTACACGAGGCTTG GGG (reversed) Intergenic
No off target data available for this crispr