ID: 1001652787

View in Genome Browser
Species Human (GRCh38)
Location 5:173327670-173327692
Sequence CGGGAGGCCCAGAGGGTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 378}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001652787_1001652801 24 Left 1001652787 5:173327670-173327692 CCGGGGACCCTCTGGGCCTCCCG 0: 1
1: 0
2: 3
3: 42
4: 378
Right 1001652801 5:173327717-173327739 TTTGCACCGGACCCGGGATTCGG 0: 1
1: 0
2: 0
3: 1
4: 25
1001652787_1001652802 25 Left 1001652787 5:173327670-173327692 CCGGGGACCCTCTGGGCCTCCCG 0: 1
1: 0
2: 3
3: 42
4: 378
Right 1001652802 5:173327718-173327740 TTGCACCGGACCCGGGATTCGGG 0: 1
1: 0
2: 0
3: 0
4: 29
1001652787_1001652803 26 Left 1001652787 5:173327670-173327692 CCGGGGACCCTCTGGGCCTCCCG 0: 1
1: 0
2: 3
3: 42
4: 378
Right 1001652803 5:173327719-173327741 TGCACCGGACCCGGGATTCGGGG 0: 1
1: 0
2: 0
3: 1
4: 30
1001652787_1001652804 27 Left 1001652787 5:173327670-173327692 CCGGGGACCCTCTGGGCCTCCCG 0: 1
1: 0
2: 3
3: 42
4: 378
Right 1001652804 5:173327720-173327742 GCACCGGACCCGGGATTCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 44
1001652787_1001652806 30 Left 1001652787 5:173327670-173327692 CCGGGGACCCTCTGGGCCTCCCG 0: 1
1: 0
2: 3
3: 42
4: 378
Right 1001652806 5:173327723-173327745 CCGGACCCGGGATTCGGGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 111
1001652787_1001652800 18 Left 1001652787 5:173327670-173327692 CCGGGGACCCTCTGGGCCTCCCG 0: 1
1: 0
2: 3
3: 42
4: 378
Right 1001652800 5:173327711-173327733 GCGCGCTTTGCACCGGACCCGGG 0: 1
1: 0
2: 0
3: 0
4: 38
1001652787_1001652798 11 Left 1001652787 5:173327670-173327692 CCGGGGACCCTCTGGGCCTCCCG 0: 1
1: 0
2: 3
3: 42
4: 378
Right 1001652798 5:173327704-173327726 GGATGAAGCGCGCTTTGCACCGG 0: 1
1: 0
2: 0
3: 3
4: 50
1001652787_1001652799 17 Left 1001652787 5:173327670-173327692 CCGGGGACCCTCTGGGCCTCCCG 0: 1
1: 0
2: 3
3: 42
4: 378
Right 1001652799 5:173327710-173327732 AGCGCGCTTTGCACCGGACCCGG 0: 1
1: 0
2: 0
3: 0
4: 22
1001652787_1001652792 -10 Left 1001652787 5:173327670-173327692 CCGGGGACCCTCTGGGCCTCCCG 0: 1
1: 0
2: 3
3: 42
4: 378
Right 1001652792 5:173327683-173327705 GGGCCTCCCGCGTGCCGGCCGGG 0: 1
1: 0
2: 0
3: 12
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001652787 Original CRISPR CGGGAGGCCCAGAGGGTCCC CGG (reversed) Intronic
900092011 1:924688-924710 CTCGAGGGCCAGCGGGTCCCTGG - Intergenic
900130603 1:1085581-1085603 CGTGATGCCCTGAGGGCCCCGGG + Intronic
900207363 1:1437293-1437315 GGGGGGGCCCACAGGGTCGCTGG - Exonic
900646866 1:3712978-3713000 CTGGGGGCCCTGAGGGTCACAGG - Intronic
900743018 1:4342193-4342215 GGGGAGGCACTGAGAGTCCCTGG - Intergenic
900973094 1:6002217-6002239 AGGGAGGACCAGAGGGCTCCTGG + Intronic
901783622 1:11610411-11610433 TGGGAGGACCTGAGGGACCCAGG + Intergenic
901875308 1:12164086-12164108 CGGGAGGCCCAGAGCATCATGGG + Intergenic
902511245 1:16968052-16968074 CGAGGACCCCAGAGGGTCCCAGG + Intronic
902688819 1:18096881-18096903 AGGGAGGCCAAGGGAGTCCCCGG - Intergenic
903206049 1:21783234-21783256 CGGGAGGCGCAGAGGCTGCTGGG - Exonic
903337805 1:22636636-22636658 TGGGCAGCCCACAGGGTCCCTGG + Exonic
904042584 1:27593137-27593159 GGGAAGGCCCCTAGGGTCCCGGG + Intronic
904268655 1:29333611-29333633 AGGGAGGCTCAGAGGGCCTCAGG - Intergenic
904652287 1:32014390-32014412 CGGGCGACCCAGAGGGACACGGG - Intronic
905544306 1:38785653-38785675 TGGGTGGCCCAGAGCATCCCTGG - Intergenic
905880011 1:41457322-41457344 CAGGGGGCCCAGAGGGTTCCGGG + Intergenic
906518336 1:46452657-46452679 CGGGAGGCCCAGAGGAGGCCAGG - Intergenic
906626181 1:47327731-47327753 GGGGAGGTCCAGTGTGTCCCAGG - Intergenic
907481445 1:54748109-54748131 TGGGAGGCCAAGAGTCTCCCTGG - Intergenic
909649721 1:77960414-77960436 CTGGAGGCCCAGGAGGTCCATGG + Exonic
910326714 1:86017159-86017181 CTGGAGGGCCAGATGGTCCTTGG + Exonic
910459034 1:87428379-87428401 CAGGAGTCCCAGAAGGTCCGGGG + Intergenic
912486715 1:110034853-110034875 CGGGCGGCGCCGGGGGTCCCGGG + Intronic
912804234 1:112743268-112743290 AGGGAGGTACAGTGGGTCCCGGG + Intergenic
914316318 1:146515297-146515319 CAGGAGTCCCAGAAGGTCCAGGG + Intergenic
914498038 1:148218064-148218086 CAGGAGTCCCAGAAGGTCCAGGG - Intergenic
914748385 1:150515678-150515700 CAGGAGGCCCAGGCGGCCCCGGG - Intergenic
915111134 1:153565381-153565403 GGGAAGGCCCAGAGAGGCCCAGG + Intronic
915496540 1:156286079-156286101 TGGGAGACCCTGAGGGGCCCAGG - Intronic
917704345 1:177616438-177616460 CAGAAAGCCCTGAGGGTCCCTGG + Intergenic
918078713 1:181189987-181190009 CTGGAGGCCCAGAGGGCACCCGG - Intergenic
918093867 1:181318603-181318625 CGGGCGGCTCAGCAGGTCCCCGG + Intergenic
920678316 1:208054179-208054201 TGGGAGTCCCAGAGGGCCACAGG - Intronic
921988910 1:221342812-221342834 CAGGAGCTCCAGAGGATCCCAGG + Intergenic
922763852 1:228147765-228147787 CTGGGGACCCACAGGGTCCCTGG - Intronic
922986541 1:229870297-229870319 CAGGAGACCCAGAGGGCCCATGG + Intergenic
923107804 1:230868141-230868163 CGGGAGGGGAAGAGGGTCCGCGG + Intronic
1062930073 10:1347089-1347111 GTGCAGGCCCAGAGGGGCCCAGG + Intronic
1062938264 10:1403703-1403725 CTGCAGGCCGAGTGGGTCCCAGG - Intronic
1063362025 10:5466905-5466927 CGGGAGGGCCAGGGCCTCCCAGG + Intergenic
1063400325 10:5737520-5737542 GGGGAGGCACAGAGGGCCGCAGG - Intronic
1066488471 10:35871884-35871906 TGGGATCCCCAGAGGGACCCAGG + Intergenic
1067227230 10:44384205-44384227 TGTGAGGCTCGGAGGGTCCCTGG + Intronic
1067234834 10:44438916-44438938 CGGGGTGCCCAGAAGTTCCCAGG + Intergenic
1067436957 10:46284983-46285005 CGGGAGGCCGCGGGGGTCCACGG - Intergenic
1067834973 10:49632820-49632842 CATGAGGCCCACAGGGTTCCAGG + Intronic
1067840915 10:49679001-49679023 AGGGAGGACCCGAGGCTCCCGGG - Intergenic
1070514783 10:77194371-77194393 GGGGAGGCCCAAAGAGTCCAAGG - Intronic
1070730882 10:78827440-78827462 CGGCAGGCCCAGAGGATTCCAGG + Intergenic
1070780675 10:79135870-79135892 TGGGTGGCCGAGAGGGCCCCTGG - Intronic
1070947921 10:80408558-80408580 CGCCCGGCCCGGAGGGTCCCAGG - Exonic
1071064604 10:81615785-81615807 CAGGAGGCTCAGAGATTCCCAGG + Intergenic
1071874440 10:89829439-89829461 CGGGAGGCAAGGAGGGCCCCTGG + Intergenic
1072208257 10:93223491-93223513 CAGGAGGCCCAGAGAGCCACAGG - Intergenic
1073196414 10:101695075-101695097 CGGGGGGCCCCGAGCGGCCCTGG + Exonic
1073497934 10:103911308-103911330 AGGGAGTCCCTGATGGTCCCAGG + Intronic
1073510267 10:104038463-104038485 CCGGAGGCCCAGGGGGCCCAGGG + Exonic
1074871056 10:117576332-117576354 AGGGAGGCCCAGGGGGGCCAAGG - Intergenic
1075064917 10:119282766-119282788 CGGGGGCCCCAGAGGCTTCCGGG + Intronic
1075398261 10:122143064-122143086 CGGGTGGCCCAACTGGTCCCGGG + Intronic
1075645512 10:124093488-124093510 CCGGAGCCGCAGAGGCTCCCGGG - Exonic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1076010638 10:126985459-126985481 TGGTAGGCCCAGTGGATCCCTGG - Intronic
1076197966 10:128533741-128533763 GATGAGGCCCAGAGAGTCCCAGG - Intergenic
1076362451 10:129898838-129898860 CGGGAGGCGCAGCGGGGCCTGGG - Intronic
1076582360 10:131520264-131520286 CAGGAGTCCCAGAGGGTCCTTGG + Intergenic
1076778691 10:132711886-132711908 CCAGAGGCTCAGAGGGTACCAGG - Intronic
1076807778 10:132867791-132867813 CGGGAGGCACAGCGGGGCCGGGG - Intronic
1076822259 10:132945341-132945363 GGGGAGGCACGGAGGGTCCCTGG + Intergenic
1076890041 10:133278958-133278980 CGGGCAGCCCTGAGGCTCCCAGG + Exonic
1077160514 11:1110402-1110424 TAGGAGGCTCAGAGGGTCCGGGG - Intergenic
1077162691 11:1120968-1120990 CGAGAGGCCAGGAGGGTCCAGGG - Intergenic
1077502836 11:2917033-2917055 GGGGAGGCCCAGAGAGGCCTGGG + Intronic
1077543218 11:3157398-3157420 GGGGAGGCCAAGAGGGGGCCTGG + Intronic
1077902119 11:6497949-6497971 AGGGAGGGCCTGAGGGTCTCAGG + Exonic
1078489857 11:11758632-11758654 AGAGAGGCGCAGAGGGTCCTTGG + Intergenic
1078904473 11:15671339-15671361 CAGCAGGCCCAGAGAGCCCCAGG + Intergenic
1081872944 11:46391535-46391557 GGGGAGCCTCAGAGCGTCCCGGG + Intergenic
1082767579 11:57181436-57181458 CTGGAGTCCAAGGGGGTCCCAGG - Intergenic
1082807636 11:57460747-57460769 CGGGAGGGCCCGGGAGTCCCCGG - Exonic
1082873182 11:57962296-57962318 TAGGAGCCCTAGAGGGTCCCAGG - Intergenic
1083912894 11:65720424-65720446 CGGGAGGCGCAAAGGGCCTCAGG + Intronic
1084154049 11:67303958-67303980 CGGGAGGCCCCGTGGAGCCCCGG - Intronic
1084422449 11:69067115-69067137 CAGGAGGAGCAGAGGGGCCCAGG - Intronic
1084671472 11:70609123-70609145 CGGGCGGCCCAGAGAGGGCCTGG + Intronic
1084698013 11:70767941-70767963 GGGGAGACCCAGAGGACCCCTGG - Intronic
1084725382 11:70938475-70938497 CGGGAGGCACAGAGGCTATCAGG + Intronic
1088455950 11:110033275-110033297 CAGGAGGTGCAGAGGGTTCCAGG + Intergenic
1090112818 11:123933897-123933919 CGGAAGGCCCAAAGGGTCTCTGG + Intergenic
1091168137 11:133498514-133498536 TGGGAGGCCCAGATGGTGCGAGG - Intronic
1091357192 11:134946188-134946210 CTGCAAGCCCAGAGGGCCCCAGG + Intergenic
1091589720 12:1836054-1836076 CGTGCTGCCCAGAGGCTCCCAGG + Exonic
1091732509 12:2891268-2891290 CCCGAGGCCCAGAGGGGCCGAGG - Intronic
1091918052 12:4283225-4283247 CGGGACCCCCAGAGGCTCCCAGG + Intronic
1094870479 12:34596693-34596715 CAGGGGCCCCTGAGGGTCCCTGG + Intergenic
1095955459 12:47803229-47803251 CAGGAGACCCAGAGGCTGCCTGG + Intronic
1096462408 12:51829284-51829306 CGGGTGCCCCAGGGGGTCTCTGG + Intergenic
1097063816 12:56305570-56305592 TGGGAGGCCAAGAGGATCACTGG + Intronic
1097177001 12:57149128-57149150 TGGGAGGCTGAGAGGGTCCAGGG - Intronic
1098749689 12:74278308-74278330 CGGTGGGTCCAGTGGGTCCCTGG + Intergenic
1099205565 12:79722197-79722219 CCGTAGCCACAGAGGGTCCCAGG - Intergenic
1103035247 12:117651333-117651355 CTCAAGTCCCAGAGGGTCCCTGG + Intronic
1103700524 12:122846756-122846778 GGGGCGGCCCAGAGGCTGCCTGG + Intronic
1103907398 12:124334750-124334772 ACGGAGGCCCAGAGGGTGGCGGG - Intronic
1104838675 12:131809204-131809226 CGGCCGCTCCAGAGGGTCCCAGG + Intergenic
1104931043 12:132339637-132339659 CCACAGGCCCAGTGGGTCCCGGG - Intergenic
1104940279 12:132391972-132391994 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940318 12:132392058-132392080 CGGGGTGGCCGGAGGGTCCCTGG - Intergenic
1104940343 12:132392115-132392137 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940370 12:132392172-132392194 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940396 12:132392229-132392251 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940423 12:132392286-132392308 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940450 12:132392343-132392365 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940477 12:132392400-132392422 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940504 12:132392457-132392479 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1105203092 13:18195436-18195458 AGGGAGACCCAGAGGGTTCCAGG - Intergenic
1106226277 13:27789630-27789652 CGCCAGGCCCAGGGGCTCCCGGG + Intergenic
1110450791 13:75636111-75636133 CGGGAACCCCAGCGGGGCCCGGG + Intronic
1113426035 13:110209409-110209431 CGGGAGGGCCTGGGGGACCCTGG + Exonic
1115664647 14:35534099-35534121 GGGGAGGCCCGGCGGGACCCCGG + Exonic
1115731065 14:36270590-36270612 CTGGAGGCCCTGAGGGATCCAGG + Intergenic
1115784305 14:36806959-36806981 AGGGAGGTCCAGTGGGTACCAGG + Intronic
1117908398 14:60613490-60613512 CTGTGGGCCCAGAGGGTCCAGGG + Intergenic
1118346410 14:64944378-64944400 CTGGAGGCCCAGAGAGTACTAGG - Intronic
1119549039 14:75494727-75494749 CATGATGCCCAAAGGGTCCCTGG + Intergenic
1121108562 14:91296527-91296549 CGTGGGGCCCTCAGGGTCCCAGG + Intronic
1121121151 14:91376692-91376714 GGGGAGGCCCAGGGGTCCCCTGG + Intronic
1121137275 14:91510175-91510197 CGGGAGACTCTGAGGGCCCCCGG + Intronic
1121731365 14:96189402-96189424 CGGGCTGCCCAGAGCCTCCCAGG - Intergenic
1122042604 14:98999690-98999712 CGGGGGGCCCAGAGGGAAGCCGG - Intergenic
1122043447 14:99007071-99007093 CTCGGGGCCCAGAGGGTTCCCGG + Intergenic
1122137713 14:99644577-99644599 GGGGAGCCCCAGTGGGTCCTGGG + Intergenic
1122424351 14:101597028-101597050 CAGGAAGCCCAGGGGGTCACAGG + Intergenic
1122488071 14:102094967-102094989 CAGGAGCCCCAGAGGCTCCCGGG + Intronic
1122624785 14:103078985-103079007 GGGGAGGCCCAGAGAGGGCCAGG + Intergenic
1122797356 14:104212680-104212702 CTGGAGGCCCAGAGAGGACCCGG + Intergenic
1122922917 14:104887341-104887363 CCACAGGCCCCGAGGGTCCCTGG + Exonic
1122938832 14:104972186-104972208 GGGGAGGCCCAGAAGGGGCCTGG - Intronic
1124604448 15:31160353-31160375 TGGGAGGGCAAGAGGCTCCCAGG - Intronic
1127699270 15:61481245-61481267 CTGGAGGCTGAGAGGGGCCCAGG + Intergenic
1128084764 15:64878103-64878125 CTGGAGGGCCAGAGGGACCCCGG + Intronic
1128520282 15:68370481-68370503 ACGGGGGCCCAGAGTGTCCCAGG + Intronic
1129300271 15:74621396-74621418 CGACTGGCCCAGAGGATCCCAGG + Intronic
1129780195 15:78264799-78264821 CGTGAAGCCCAGCGCGTCCCCGG + Exonic
1131095651 15:89652902-89652924 CTGGAGGCTCAGAGGCTGCCAGG - Exonic
1131108692 15:89751038-89751060 CGGGGGTCCCGGAGGGTGCCTGG + Exonic
1132045762 15:98561753-98561775 AGAGAGGCCCACAGGGCCCCAGG + Intergenic
1132523025 16:400140-400162 CGGGAGCAGCAGATGGTCCCTGG + Intronic
1132574628 16:658774-658796 CCGGAGGCACAGAGGATCCTTGG - Intronic
1132609352 16:807549-807571 CGGGACGGCCACAGGGGCCCAGG - Exonic
1132848129 16:2009980-2010002 CGCGTGGCCCAGAGGAGCCCGGG - Intronic
1133058707 16:3160437-3160459 CGGGAGACCCAAGAGGTCCCGGG + Intergenic
1133247100 16:4456140-4456162 GTAGAGGCCCAGAGAGTCCCTGG + Exonic
1136016863 16:27406040-27406062 AAGGAGGCCCAGAGAGGCCCAGG - Intronic
1136061939 16:27732621-27732643 AGGGAGGGCCAGGGGCTCCCTGG + Intronic
1136089229 16:27906555-27906577 CAGGAGGTGCAGAGGGCCCCGGG - Intronic
1136124640 16:28169091-28169113 CGTGAGGCCCTGAGGGTGCCGGG - Intronic
1136365197 16:29806445-29806467 CGGGAGGCCCCGCGGGGCCGGGG - Intronic
1136417671 16:30113587-30113609 CGGCAGGCTCAGCAGGTCCCAGG - Exonic
1136500007 16:30665334-30665356 CGGGAGGCCCGGAGGCAGCCCGG - Exonic
1136566496 16:31073622-31073644 CGGGAAGCCGCGAGGGCCCCGGG - Intronic
1138868226 16:60849579-60849601 CAGCAGGTCCAGTGGGTCCCTGG + Intergenic
1139088716 16:63618259-63618281 CAGGAGGCAGAGAGGCTCCCGGG - Intergenic
1139200867 16:64975563-64975585 GGGGAGGCTGAGAGAGTCCCAGG + Intronic
1139354164 16:66357396-66357418 GGGGAGGCACAGAGGGATCCGGG - Intergenic
1139421347 16:66851291-66851313 GGGGAGCCCCAGAGGGTCACAGG - Intronic
1139719866 16:68843743-68843765 CGGGCGGCCCTGAGAGTCCCGGG - Intronic
1141399327 16:83733356-83733378 CGGGAGGGCTGCAGGGTCCCTGG - Intronic
1142156274 16:88534118-88534140 CGGCCGGCCCAGGGGGTCCCGGG - Exonic
1142476086 17:191119-191141 TGGGAGCCCCAGAAGGTTCCAGG - Intergenic
1144461702 17:15463831-15463853 AGGGAGCCCCAGAAGGTCCTAGG + Intronic
1144774398 17:17777754-17777776 ACTGAGGCCCAGAGGGGCCCAGG + Intronic
1146850775 17:36219823-36219845 CAGTGGGCCCAGTGGGTCCCTGG + Intronic
1147400648 17:40178283-40178305 GGGGGCGCCCAGAGGGGCCCAGG - Intronic
1147686429 17:42289063-42289085 CGGGAGGCCCACAGGCCCCCTGG - Intronic
1148793827 17:50187875-50187897 CAGGAGGGCCAGGGGGACCCTGG + Exonic
1148796358 17:50199246-50199268 CGGGAGGTCCGGGGGGTCCGGGG + Exonic
1149605006 17:57918309-57918331 TGGCAGACCCAGAGGGTTCCCGG - Intronic
1151200689 17:72465746-72465768 CGGGAGGCACAGTGGGTGACAGG - Intergenic
1151599471 17:75097486-75097508 AAGGAGGCGCAGAGGGGCCCAGG + Intronic
1152281024 17:79384960-79384982 GGAGAGGCCCAGAAGGTCCCTGG + Intronic
1152410162 17:80119082-80119104 CGGCAGGCGCAGGGGGACCCCGG - Intergenic
1152652248 17:81500063-81500085 CGGGTGGTCCAGAGGAGCCCGGG - Intergenic
1152723493 17:81934174-81934196 CAGGGGGCCCCGAGGTTCCCTGG - Intronic
1152931844 17:83113967-83113989 TGGGGGGCACAGAGGGGCCCAGG + Intergenic
1153748619 18:8206952-8206974 CTGGTGGCCCAGATGTTCCCTGG - Intronic
1154216208 18:12418646-12418668 CAGGAGGCTCAGAGGCTTCCTGG + Intronic
1155053057 18:22165035-22165057 CGGGCGGACAAGGGGGTCCCCGG - Intergenic
1156994194 18:43447070-43447092 CTGGAGTCCCAGAGGGTCAGGGG - Intergenic
1157601013 18:48893306-48893328 TGGGAGCCCCAGAGGGAGCCGGG - Intergenic
1160262851 18:77311429-77311451 CTGGAGCCACAGAGGCTCCCAGG + Intergenic
1160404017 18:78632130-78632152 TGGGAGGTCCAGCAGGTCCCAGG - Intergenic
1160595324 18:79969462-79969484 CTGGAGGTTCAGAGGATCCCTGG - Intronic
1160701376 19:508959-508981 GGGCAGGCCCAGAGGGTCAGTGG + Intronic
1160715240 19:573327-573349 CGGGGGCCCCAGAGAGTCTCAGG - Intronic
1160736001 19:662729-662751 CGAGAGGCCGCGAGGATCCCAGG - Intronic
1160753666 19:747173-747195 TAGGAGGCCCAGAGGGTGGCAGG - Exonic
1160829208 19:1095112-1095134 CGGGAGGCCCAGAGGTCGCCGGG - Intronic
1160833985 19:1116183-1116205 CGGGACCCCCACAGGGACCCAGG - Intronic
1161030985 19:2057662-2057684 GGGGGGGCCCACAGGGTCCAGGG - Intergenic
1161161349 19:2763274-2763296 AGTGAGGCCAGGAGGGTCCCCGG - Intronic
1161302908 19:3551548-3551570 CGGGAGGCCCAGGTGGGCCTGGG + Intronic
1161592159 19:5133758-5133780 CTGGCTGCCCACAGGGTCCCTGG - Intronic
1161793885 19:6375669-6375691 GGGAAGTCACAGAGGGTCCCTGG + Intronic
1161961765 19:7527380-7527402 CCGCAGGCCCAGAGAGTGCCAGG + Intronic
1162183627 19:8888043-8888065 CTGGAGTCCCAGATGTTCCCAGG + Exonic
1162377829 19:10315710-10315732 CGGGCGGCCCGGAGCGGCCCGGG - Exonic
1163551682 19:17969091-17969113 TGGGAATCCCTGAGGGTCCCAGG + Intronic
1164222053 19:23203827-23203849 CGGGAAGGACAGAGGGACCCAGG - Intergenic
1164747724 19:30628299-30628321 CAGGAGGCCTACAGGGTCCTGGG - Intronic
1164927067 19:32139123-32139145 TGGGTGGCCCAGATGGTCCAGGG - Intergenic
1165015943 19:32879992-32880014 GGGGAGGCCCTGAGGGGCCGAGG + Intronic
1165473126 19:36014768-36014790 CTGAAGGCCCAGGGGGTCCAGGG - Exonic
1165775838 19:38403798-38403820 GGGGCGGCCCAGAGGGTACGAGG + Intronic
1165894196 19:39131692-39131714 GGGCAGGACCGGAGGGTCCCAGG - Intronic
1166067012 19:40365975-40365997 AGGGAGGCCCCGATGATCCCTGG + Intronic
1166353990 19:42216613-42216635 AGGGAGGCCCAGCGGGAGCCAGG + Intronic
1166737923 19:45097132-45097154 TGAGAGGCCCAGAGGGTCTGGGG + Intronic
1166995118 19:46716418-46716440 CGGGGGGCCCCGGGGGACCCTGG + Exonic
1167358442 19:49017659-49017681 CAGGATGCCCGGAGCGTCCCCGG + Intergenic
1167645322 19:50702600-50702622 CGGGGGGCTCAGGGGGCCCCGGG - Exonic
1168121438 19:54254398-54254420 TGGGATCCCCAGAGGGTCCTGGG + Exonic
1168166557 19:54552227-54552249 CAGGATGTCCAGGGGGTCCCTGG - Intergenic
1168640688 19:58029440-58029462 GGGGGCTCCCAGAGGGTCCCAGG + Intergenic
925456814 2:4023124-4023146 AGGGAGGCACAAAGGGACCCAGG - Intergenic
925990035 2:9247354-9247376 AGGGAGTCCCAGACGGTCCCCGG + Intronic
926192818 2:10741447-10741469 GGGGAGGCCCAGAAGCTTCCAGG - Intronic
927193688 2:20533765-20533787 GGGGAGGCCCACAGGCTCCCAGG - Intergenic
927256236 2:21043433-21043455 TGGGAGGCCCTCAGGGACCCGGG + Intronic
929822220 2:45282748-45282770 AGGGAGGCCCATAGGGGCCCAGG + Intergenic
932141973 2:69287055-69287077 CCAGAGGCACAGAGGGTTCCTGG + Intergenic
933758849 2:85661134-85661156 CCTGAGGGCCAGAGAGTCCCTGG + Intronic
936059698 2:109286398-109286420 CTGGAGGCCCAGAGGGGCAAAGG + Intronic
936721470 2:115256464-115256486 CCACAGGCTCAGAGGGTCCCAGG - Intronic
936921231 2:117690619-117690641 CAGGAGGCCCAGAAGCTCACAGG + Intergenic
937289328 2:120772586-120772608 CCATAGGCCCAGAGGTTCCCAGG + Intronic
937852725 2:126649935-126649957 CGGTGGGCCCAGTGGGTCCCCGG - Intergenic
938058350 2:128233435-128233457 CGGGAGTGCCATGGGGTCCCTGG + Intergenic
938067411 2:128288746-128288768 GGGGAGGCCCTGAGCCTCCCAGG - Intronic
942278529 2:174340298-174340320 CTGGAGGCCCAGAGGGTGCCTGG + Intergenic
943523593 2:188988077-188988099 CGGGAGGGCCTGGGGGGCCCTGG - Exonic
943725338 2:191246118-191246140 AGGGAGGCCCACAGCGTCCCGGG - Intronic
943750020 2:191501272-191501294 TGGGAGGCCCATAGGCTGCCAGG + Intergenic
945544718 2:211136968-211136990 CAGTAGGTCCAGTGGGTCCCTGG + Intergenic
946388633 2:219401912-219401934 CGGGAGGCCACCAGGGTCCCAGG + Intergenic
948046678 2:234951330-234951352 CCGGGGGCCCAGAGGCGCCCAGG + Intergenic
948668904 2:239553836-239553858 CTGGAGGTGCAGAGGGGCCCGGG - Intergenic
948873468 2:240815450-240815472 CGGGAGGCCCAGAGGGAAGGGGG + Intronic
1169279338 20:4253891-4253913 AGGGAGGCCTCGAGGGTCTCAGG - Intergenic
1169327471 20:4687030-4687052 CGCGATGCCCAGAGGGTGCTTGG + Intronic
1170314961 20:15031884-15031906 CGGGAGGCAGAAAGGGTCCTGGG - Intronic
1170430024 20:16267323-16267345 TGGGAGGCTCAGAGTCTCCCTGG - Intergenic
1170575910 20:17661354-17661376 TGGGAGGCCCAGAAGATGCCAGG + Intronic
1170627626 20:18041734-18041756 AGAGAGGCCATGAGGGTCCCCGG + Intronic
1170889129 20:20364448-20364470 CGGGAGGCCCGGAAGGTGCCTGG + Intergenic
1172034468 20:32001587-32001609 TGGGGGGTCCACAGGGTCCCTGG + Exonic
1172249537 20:33469191-33469213 GAGGAGGCTCAGAGGGTCCAGGG + Intergenic
1172287787 20:33753291-33753313 TGGGACGCCCAGGGGGGCCCAGG - Exonic
1172993207 20:39050801-39050823 TGGGATGCCCAGACTGTCCCAGG + Intergenic
1173865014 20:46307936-46307958 CGGGGGTCCCGGAGGCTCCCGGG + Intronic
1174373945 20:50113029-50113051 CAGGAGGCTTTGAGGGTCCCCGG + Intronic
1175220801 20:57415310-57415332 CGGGAGGCCCAGGAGGTATCTGG - Intergenic
1175385843 20:58594567-58594589 CGGGAATCCCAGGGGGTCTCCGG + Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175762968 20:61573600-61573622 CAGGAGGCCCCGAGGCTCCTGGG - Intronic
1175896274 20:62336832-62336854 CGGAAGGCCAAGGGTGTCCCAGG + Intronic
1175998602 20:62822107-62822129 CGGGGAGTCCAGAAGGTCCCTGG - Exonic
1176414678 21:6467698-6467720 CGGGCAGGCCGGAGGGTCCCAGG - Intergenic
1176714868 21:10342569-10342591 AGGGAGACCCAGAGGGTTCCAGG + Intergenic
1179639098 21:42735506-42735528 CTGGAGGCTCTGAGGGGCCCTGG + Intronic
1179690178 21:43076020-43076042 CGGGCAGGCCGGAGGGTCCCAGG - Intronic
1180079903 21:45481959-45481981 CCGGAGGGCCTGGGGGTCCCTGG - Exonic
1180252411 21:46597971-46597993 TGGGAGGCCCGGAGGCTCGCAGG - Intergenic
1180534774 22:16387623-16387645 TGGGAGGCGCAGAGTGTCCTGGG + Intergenic
1180603480 22:17037369-17037391 AGGGAGACCCAGAGGGTTCCAGG - Intergenic
1180784323 22:18538502-18538524 CTGGCGGCCCAGCTGGTCCCGGG + Intergenic
1180840818 22:18958089-18958111 AGATCGGCCCAGAGGGTCCCTGG - Intergenic
1181060669 22:20280685-20280707 AGATCGGCCCAGAGGGTCCCTGG + Intronic
1181127898 22:20712555-20712577 CTGGCGGCCCAGCTGGTCCCGGG + Exonic
1181241226 22:21477859-21477881 CTGGCGGCCCAGCTGGTCCCGGG + Intergenic
1181487050 22:23238134-23238156 CGGGATGACCAGAGGGCCCAGGG - Intronic
1181497001 22:23292981-23293003 CCGGAAGCCAAGAGGGTCACGGG - Intronic
1181982533 22:26775604-26775626 CAGGAGAGCCAGAGGGTGCCAGG + Intergenic
1182284008 22:29233428-29233450 CTGGAGGCCCAGTGGGTCCCTGG - Exonic
1182293320 22:29298736-29298758 CAGGAGGCCCAGGAGGTCCTGGG + Exonic
1182578789 22:31291413-31291435 AGGGAGGCCCAGCAGGGCCCGGG - Intronic
1184256589 22:43290521-43290543 GGGGAGGTGCAGAGGGCCCCAGG - Intronic
1184803069 22:46774296-46774318 CAGGAGGCCCAGAGGGAACAGGG + Intronic
1185045769 22:48528064-48528086 CGGGGGGCCCCGGGGGGCCCAGG - Intronic
1185093088 22:48786775-48786797 CGGGAAACCCACAGGGTCCCTGG - Intronic
1185274202 22:49943358-49943380 CCACAGGCCGAGAGGGTCCCAGG + Intergenic
950964137 3:17134409-17134431 ACGGAGGCCCTGAGGGTCCATGG - Intergenic
953173044 3:40524924-40524946 CCGGGGGCCTAGAGGGACCCTGG + Exonic
954053961 3:48006458-48006480 CAGTGGGCCCAGTGGGTCCCTGG + Intronic
954133412 3:48571118-48571140 CAGGAGGCCCAGGGGAGCCCGGG + Exonic
954134301 3:48575081-48575103 CGGGGGGCCCAGGGGTTCCAGGG + Exonic
958934151 3:100239418-100239440 TGGTGGGTCCAGAGGGTCCCTGG + Intergenic
960447916 3:117770401-117770423 AGGGAGGCCTAGTAGGTCCCAGG + Intergenic
961536793 3:127575598-127575620 AGGGAGGCCTAGAGGGGCCCCGG - Intronic
961633890 3:128321074-128321096 TGGGAGGCCCTGGGGGTGCCAGG + Intronic
961649157 3:128408830-128408852 CTGAAGGCCCAGAGCGCCCCAGG - Intergenic
961818001 3:129561238-129561260 CCCGAGACCCAGAGGATCCCGGG + Intronic
962670977 3:137708390-137708412 ATGGAGGCCCACAGAGTCCCAGG + Intergenic
964041629 3:152268621-152268643 CGGGAGGCCGAGGGGATCCACGG + Exonic
964356217 3:155854188-155854210 CTAGAGGCCCAGAGGATGCCTGG + Exonic
964451441 3:156816755-156816777 AAGGAGGCCGAGAGGGGCCCAGG + Intergenic
967128561 3:186449135-186449157 TGAGATTCCCAGAGGGTCCCTGG + Intergenic
968467941 4:762356-762378 CTGGTGGCCCAGGGGCTCCCTGG - Intronic
968519041 4:1027489-1027511 CGTGAGGCCCACTGCGTCCCCGG + Intergenic
968929279 4:3569965-3569987 CGGGAGACAAAGAGGGTTCCCGG + Intergenic
968965357 4:3766597-3766619 CGGGAGGACCATGGCGTCCCCGG + Exonic
969347484 4:6578521-6578543 CTGGAGGTCCTGAGGGACCCTGG - Intronic
969520873 4:7677201-7677223 CGGGAGGCCGAGGGGGACCCAGG - Intronic
970089341 4:12387558-12387580 CAGTGGGCCCAGTGGGTCCCTGG - Intergenic
971500558 4:27313860-27313882 CGGGAGGCCCAGGTGCTGCCTGG - Intergenic
974470198 4:62309605-62309627 CACGTGGCTCAGAGGGTCCCAGG + Intergenic
975701870 4:77075298-77075320 AGGGCGGCCCCGAGGTTCCCCGG + Intronic
976002475 4:80388119-80388141 TGGGATGCCCAGGGGGGCCCAGG + Intronic
976034344 4:80796973-80796995 CAGTAGGTCCAGTGGGTCCCTGG - Intronic
979122920 4:116926265-116926287 CGGGTGGCCTGGCGGGTCCCGGG - Intergenic
983537850 4:168877719-168877741 CTGGAGCTTCAGAGGGTCCCTGG - Intronic
985575394 5:671325-671347 CTTGGGGCCCAGAGGGACCCCGG + Intronic
985614760 5:913014-913036 GGGCAGGCCCAGTGGGTCCATGG - Intronic
985688428 5:1294235-1294257 TGGCAGGCCCAGGGGGACCCCGG + Exonic
986261749 5:6153442-6153464 CAGTGGGTCCAGAGGGTCCCTGG - Intergenic
987073526 5:14359670-14359692 TGGGAGGGAGAGAGGGTCCCTGG + Intronic
987578501 5:19759529-19759551 CAGTGGGCCCAGTGGGTCCCTGG - Intronic
996205848 5:120734209-120734231 TGGGAAGCCCAGATGGTCACCGG - Intergenic
997471456 5:134119682-134119704 CGGCAGGTCCAGAGCGTGCCTGG + Intronic
997817746 5:137034918-137034940 CGGGCGGCCCAGAGGGGTCCAGG + Intronic
1001652787 5:173327670-173327692 CGGGAGGCCCAGAGGGTCCCCGG - Intronic
1001784389 5:174399486-174399508 CAAGAGGCAGAGAGGGTCCCAGG + Intergenic
1002192437 5:177485339-177485361 CGGCTGGCCCCGAGGGTCCTAGG - Intronic
1002364679 5:178700681-178700703 CGAGGAGCTCAGAGGGTCCCAGG + Intergenic
1002596922 5:180329805-180329827 CGGGAGGACGAGAGGGGTCCGGG - Intronic
1002912965 6:1505295-1505317 CAGGGAGCCCAGAAGGTCCCAGG + Intergenic
1003597926 6:7491042-7491064 GGGGTGGCCCAGAGGGCCTCGGG + Intergenic
1005781915 6:29201497-29201519 CAGGAGGCCCACAGGCTCCTGGG + Intergenic
1006297507 6:33176468-33176490 CCTGAGGTCCAGAGGGACCCTGG + Exonic
1006436509 6:34028439-34028461 CGGGATGCCGGGTGGGTCCCTGG - Intronic
1006445759 6:34078942-34078964 CGGGAGGCTGAGAGAGGCCCAGG + Intronic
1007485162 6:42175821-42175843 CTGGGGGCAGAGAGGGTCCCAGG - Intronic
1007487360 6:42190641-42190663 CCTGAGACCCAGAGGTTCCCAGG + Intronic
1007625307 6:43243342-43243364 CGGGACAGCCAGAGAGTCCCAGG + Intergenic
1008109429 6:47477343-47477365 AGGGAGGCCCAGATGCTGCCAGG - Intergenic
1009934389 6:70216968-70216990 CGGGAAGCCCAGGAGGTCCCGGG + Exonic
1010307658 6:74343569-74343591 CGCGTGGCTCAGAGGGTCCTAGG - Intergenic
1012421873 6:99074691-99074713 CAGGAGGCTCAGAGGATACCGGG + Intergenic
1013619343 6:111873062-111873084 CGGAAGGCCCACCGGCTCCCGGG - Exonic
1016714196 6:147204479-147204501 GGGGAGGCACAGGGGGTCCCCGG - Intronic
1016885378 6:148955059-148955081 AGGGAGGCCCGGAGGTTCCCAGG - Intronic
1017812608 6:157994877-157994899 AGGGAGTCCCAGGGGGTTCCTGG + Intronic
1018839285 6:167507142-167507164 CGGGAGGCTCTGCGGGACCCTGG - Intergenic
1018918126 6:168150699-168150721 CGTGAGGCCCCTAGAGTCCCCGG + Intergenic
1018936980 6:168279969-168279991 AGGCAGGGTCAGAGGGTCCCTGG + Intergenic
1018936995 6:168280012-168280034 CGGTGGGGTCAGAGGGTCCCTGG + Intergenic
1019009812 6:168835135-168835157 AGAGAGGCTCAGAGAGTCCCAGG + Intergenic
1019337067 7:490545-490567 CAGGAGGTCCAGAGGAGCCCAGG + Intergenic
1019421410 7:952961-952983 TGGGAGGCCCAGAGGGTGGCTGG + Intronic
1019424025 7:964725-964747 CTGGAGGCCCAGAGCCCCCCAGG - Intronic
1019522720 7:1467970-1467992 CAAGAGGCCCAGAGGGTCCCAGG + Intergenic
1019702489 7:2480685-2480707 AGGGAGGCAGAGAGGGACCCAGG - Intergenic
1019989493 7:4682063-4682085 CGGGAGGGCCGGCGGGCCCCCGG - Intergenic
1020006129 7:4784575-4784597 CGGGGTGTCCAGAGGATCCCCGG - Intronic
1021202343 7:17741148-17741170 CTGGAGGACCAGAGGGGCCAGGG - Intergenic
1021969241 7:25950975-25950997 CGGGGCGCCCAGAGGCTCCCGGG + Intergenic
1023810220 7:43906259-43906281 CGCGAGGCCCGGAGGTGCCCGGG - Intronic
1023865953 7:44238563-44238585 GGGGAGGCCCAGGGCGTCCTCGG - Intronic
1024226437 7:47329514-47329536 GCGGTGGCCCTGAGGGTCCCAGG - Intronic
1024709080 7:51995472-51995494 TCAGAGGACCAGAGGGTCCCTGG - Intergenic
1030177704 7:106671940-106671962 CGGGAAGCACAGAGGGTCGGGGG + Intergenic
1031676397 7:124617116-124617138 CAGTGGGTCCAGAGGGTCCCTGG + Intergenic
1032037575 7:128531502-128531524 AGGGAGGCGCAGAAGGGCCCAGG - Intergenic
1033283413 7:140021694-140021716 AGGGAGGCCGACAGGTTCCCAGG - Intergenic
1033659693 7:143394989-143395011 CGGGAGGACCAGCTGGTCCCTGG - Exonic
1034098924 7:148435482-148435504 AGGGAGGCAGAGAGGGTGCCTGG - Intergenic
1034264901 7:149776145-149776167 CTGATGCCCCAGAGGGTCCCTGG - Intergenic
1035018536 7:155787317-155787339 CTGGCTGCCCCGAGGGTCCCAGG + Intergenic
1035388105 7:158488260-158488282 AGGGAGCCCCAGGGGGTCCTAGG + Intronic
1035568611 8:658311-658333 CGGGAGGCCCAGTGGAGGCCAGG - Intronic
1035575044 8:699011-699033 CGGGAGGCTCAGTGGAGCCCAGG + Intronic
1036041543 8:5087789-5087811 CGAGAGGACAAGAGGGTGCCAGG + Intergenic
1037937877 8:22927538-22927560 CGGGAGGCACAGAGGCTACCAGG - Intronic
1038359785 8:26865213-26865235 CGGCAGGTGGAGAGGGTCCCCGG - Exonic
1038575739 8:28701896-28701918 CGGGAGGGCTAACGGGTCCCTGG + Intronic
1040299434 8:46180294-46180316 TGGGAGGGCCACAGGGACCCAGG - Intergenic
1040573185 8:48627410-48627432 TGGGAAGCCCAGGGGTTCCCAGG + Intergenic
1041181076 8:55248808-55248830 CTGGAGTCTCAGAGTGTCCCAGG + Intronic
1041291773 8:56314890-56314912 TGGGAGGCACAAAGTGTCCCAGG + Intronic
1041600890 8:59716385-59716407 CAGGAGGTCCTGGGGGTCCCAGG + Intergenic
1042001219 8:64125197-64125219 CAGTAGACCCAGTGGGTCCCTGG - Intergenic
1045115423 8:98974584-98974606 CGGGAGGAGGAGAGGGTCCCGGG + Intergenic
1047292086 8:123540331-123540353 AGGGACGGCCAGATGGTCCCTGG - Intronic
1048439288 8:134448041-134448063 CATGATGCCCAGAGGGTCTCTGG - Intergenic
1048846306 8:138606380-138606402 CCGGAGGCCCACGGGGACCCAGG + Exonic
1048974224 8:139662155-139662177 GGGGAGGCCCAGAGGCCCACAGG - Intronic
1049175264 8:141188829-141188851 CGTCAGGGCCAGAGGCTCCCAGG + Intronic
1049187391 8:141264410-141264432 CGGGAGGCAGAGAGGCTGCCGGG + Intronic
1049268648 8:141682705-141682727 CAGGAGGCCCAGAGGGAGACAGG + Intergenic
1049315635 8:141965670-141965692 CGTGAGGCCCAGAGGCTCAGTGG - Intergenic
1049540726 8:143207673-143207695 AGGGAGACACAGTGGGTCCCGGG - Intergenic
1049608118 8:143539105-143539127 CAGGAGGGTCTGAGGGTCCCGGG + Exonic
1049773737 8:144395390-144395412 GGCCAGGCCCAGAAGGTCCCTGG + Intronic
1053390400 9:37731042-37731064 CAGGAGGTCCAGGGGGTCCTTGG - Exonic
1054460996 9:65462492-65462514 CGGGAGACAAAGAGGGTTCCTGG - Intergenic
1057796379 9:98160908-98160930 CGAGAGTCCTAGAGGGTCACAGG - Intronic
1057885488 9:98826666-98826688 AGGGAGGCCCAGAAGGCCCCGGG + Intronic
1060042111 9:120308694-120308716 CAGGAGGCCTAGAGGGAACCAGG - Intergenic
1061059931 9:128245188-128245210 CGGGAGCCCCAGAGGGCGGCTGG - Intronic
1062025439 9:134338194-134338216 AGGGAGGCCCAGGGAGGCCCCGG - Intronic
1062102280 9:134734508-134734530 CGGGACGCCCGCAGGGCCCCAGG - Intronic
1062149847 9:135012286-135012308 TGGGAGGGCCAGAGGGTCTGGGG + Intergenic
1062269408 9:135701797-135701819 CGGGAGGTGCTGACGGTCCCTGG + Intergenic
1062365217 9:136205116-136205138 CGCCAGGCCCAGTGGCTCCCGGG - Intergenic
1062460146 9:136659554-136659576 CGGGAGGCCCGGGAGGGCCCGGG + Exonic
1062468387 9:136691556-136691578 ACGGAGGCCCAGAGGGTGCCTGG + Intergenic
1062480477 9:136748590-136748612 CAGGAGGCCAGGAGGGTTCCTGG - Intergenic
1062555751 9:137112762-137112784 AGTGAGGCCCAGAGGATCACGGG - Exonic
1185480260 X:440902-440924 CGTGAGGCTCAAAGGGGCCCTGG + Intergenic
1187158801 X:16745365-16745387 TGGGAGGCCCAGGGGCTCTCTGG + Intronic
1189438308 X:41012276-41012298 TGGGAGTCTCAGGGGGTCCCAGG - Intergenic
1197380497 X:125732480-125732502 CACGGGGCCCAGTGGGTCCCTGG - Intergenic
1198242768 X:134801502-134801524 CTGGAGGGCCAAAGGGTCCCTGG - Intronic