ID: 1001653238

View in Genome Browser
Species Human (GRCh38)
Location 5:173329723-173329745
Sequence TCCAGGAGGAGGGTGGGGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001653238_1001653248 -6 Left 1001653238 5:173329723-173329745 CCCGTCCCCACCCTCCTCCTGGA No data
Right 1001653248 5:173329740-173329762 CCTGGAGAACAGGTGAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001653238 Original CRISPR TCCAGGAGGAGGGTGGGGAC GGG (reversed) Intergenic
No off target data available for this crispr