ID: 1001653248

View in Genome Browser
Species Human (GRCh38)
Location 5:173329740-173329762
Sequence CCTGGAGAACAGGTGAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001653238_1001653248 -6 Left 1001653238 5:173329723-173329745 CCCGTCCCCACCCTCCTCCTGGA No data
Right 1001653248 5:173329740-173329762 CCTGGAGAACAGGTGAGCCCCGG No data
1001653235_1001653248 -4 Left 1001653235 5:173329721-173329743 CCCCCGTCCCCACCCTCCTCCTG No data
Right 1001653248 5:173329740-173329762 CCTGGAGAACAGGTGAGCCCCGG No data
1001653236_1001653248 -5 Left 1001653236 5:173329722-173329744 CCCCGTCCCCACCCTCCTCCTGG No data
Right 1001653248 5:173329740-173329762 CCTGGAGAACAGGTGAGCCCCGG No data
1001653234_1001653248 -3 Left 1001653234 5:173329720-173329742 CCCCCCGTCCCCACCCTCCTCCT No data
Right 1001653248 5:173329740-173329762 CCTGGAGAACAGGTGAGCCCCGG No data
1001653229_1001653248 23 Left 1001653229 5:173329694-173329716 CCCGGCGTTGGCGCGCACTCGCC 0: 1
1: 0
2: 1
3: 5
4: 45
Right 1001653248 5:173329740-173329762 CCTGGAGAACAGGTGAGCCCCGG No data
1001653230_1001653248 22 Left 1001653230 5:173329695-173329717 CCGGCGTTGGCGCGCACTCGCCC 0: 1
1: 0
2: 1
3: 7
4: 30
Right 1001653248 5:173329740-173329762 CCTGGAGAACAGGTGAGCCCCGG No data
1001653231_1001653248 2 Left 1001653231 5:173329715-173329737 CCCCTCCCCCCGTCCCCACCCTC No data
Right 1001653248 5:173329740-173329762 CCTGGAGAACAGGTGAGCCCCGG No data
1001653233_1001653248 0 Left 1001653233 5:173329717-173329739 CCTCCCCCCGTCCCCACCCTCCT No data
Right 1001653248 5:173329740-173329762 CCTGGAGAACAGGTGAGCCCCGG No data
1001653232_1001653248 1 Left 1001653232 5:173329716-173329738 CCCTCCCCCCGTCCCCACCCTCC No data
Right 1001653248 5:173329740-173329762 CCTGGAGAACAGGTGAGCCCCGG No data
1001653239_1001653248 -7 Left 1001653239 5:173329724-173329746 CCGTCCCCACCCTCCTCCTGGAG No data
Right 1001653248 5:173329740-173329762 CCTGGAGAACAGGTGAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001653248 Original CRISPR CCTGGAGAACAGGTGAGCCC CGG Intergenic
No off target data available for this crispr