ID: 1001660645

View in Genome Browser
Species Human (GRCh38)
Location 5:173390198-173390220
Sequence GCCCACATTTTTCACCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001660645_1001660651 17 Left 1001660645 5:173390198-173390220 CCCCAGGGGTGAAAAATGTGGGC No data
Right 1001660651 5:173390238-173390260 ATTTTCCACATTGTAAGAGAGGG No data
1001660645_1001660653 22 Left 1001660645 5:173390198-173390220 CCCCAGGGGTGAAAAATGTGGGC No data
Right 1001660653 5:173390243-173390265 CCACATTGTAAGAGAGGGTGAGG No data
1001660645_1001660650 16 Left 1001660645 5:173390198-173390220 CCCCAGGGGTGAAAAATGTGGGC No data
Right 1001660650 5:173390237-173390259 CATTTTCCACATTGTAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001660645 Original CRISPR GCCCACATTTTTCACCCCTG GGG (reversed) Intergenic