ID: 1001660653

View in Genome Browser
Species Human (GRCh38)
Location 5:173390243-173390265
Sequence CCACATTGTAAGAGAGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001660649_1001660653 -8 Left 1001660649 5:173390228-173390250 CCTCATGTTCATTTTCCACATTG No data
Right 1001660653 5:173390243-173390265 CCACATTGTAAGAGAGGGTGAGG No data
1001660647_1001660653 20 Left 1001660647 5:173390200-173390222 CCAGGGGTGAAAAATGTGGGCTG No data
Right 1001660653 5:173390243-173390265 CCACATTGTAAGAGAGGGTGAGG No data
1001660645_1001660653 22 Left 1001660645 5:173390198-173390220 CCCCAGGGGTGAAAAATGTGGGC No data
Right 1001660653 5:173390243-173390265 CCACATTGTAAGAGAGGGTGAGG No data
1001660646_1001660653 21 Left 1001660646 5:173390199-173390221 CCCAGGGGTGAAAAATGTGGGCT No data
Right 1001660653 5:173390243-173390265 CCACATTGTAAGAGAGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001660653 Original CRISPR CCACATTGTAAGAGAGGGTG AGG Intergenic