ID: 1001663451

View in Genome Browser
Species Human (GRCh38)
Location 5:173413451-173413473
Sequence GAAAGTGTATTTGCTGTTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001663451_1001663458 -4 Left 1001663451 5:173413451-173413473 CCGGCAACAGCAAATACACTTTC No data
Right 1001663458 5:173413470-173413492 TTTCCTGGGTGAGGGGATGGTGG No data
1001663451_1001663463 0 Left 1001663451 5:173413451-173413473 CCGGCAACAGCAAATACACTTTC No data
Right 1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG No data
1001663451_1001663466 10 Left 1001663451 5:173413451-173413473 CCGGCAACAGCAAATACACTTTC No data
Right 1001663466 5:173413484-173413506 GGATGGTGGGGGGGTTGGTGTGG No data
1001663451_1001663470 22 Left 1001663451 5:173413451-173413473 CCGGCAACAGCAAATACACTTTC No data
Right 1001663470 5:173413496-173413518 GGTTGGTGTGGAGGGGACATTGG No data
1001663451_1001663457 -7 Left 1001663451 5:173413451-173413473 CCGGCAACAGCAAATACACTTTC No data
Right 1001663457 5:173413467-173413489 CACTTTCCTGGGTGAGGGGATGG No data
1001663451_1001663467 13 Left 1001663451 5:173413451-173413473 CCGGCAACAGCAAATACACTTTC No data
Right 1001663467 5:173413487-173413509 TGGTGGGGGGGTTGGTGTGGAGG No data
1001663451_1001663462 -1 Left 1001663451 5:173413451-173413473 CCGGCAACAGCAAATACACTTTC No data
Right 1001663462 5:173413473-173413495 CCTGGGTGAGGGGATGGTGGGGG No data
1001663451_1001663468 14 Left 1001663451 5:173413451-173413473 CCGGCAACAGCAAATACACTTTC No data
Right 1001663468 5:173413488-173413510 GGTGGGGGGGTTGGTGTGGAGGG No data
1001663451_1001663460 -2 Left 1001663451 5:173413451-173413473 CCGGCAACAGCAAATACACTTTC No data
Right 1001663460 5:173413472-173413494 TCCTGGGTGAGGGGATGGTGGGG No data
1001663451_1001663465 5 Left 1001663451 5:173413451-173413473 CCGGCAACAGCAAATACACTTTC No data
Right 1001663465 5:173413479-173413501 TGAGGGGATGGTGGGGGGGTTGG No data
1001663451_1001663464 1 Left 1001663451 5:173413451-173413473 CCGGCAACAGCAAATACACTTTC No data
Right 1001663464 5:173413475-173413497 TGGGTGAGGGGATGGTGGGGGGG No data
1001663451_1001663469 15 Left 1001663451 5:173413451-173413473 CCGGCAACAGCAAATACACTTTC No data
Right 1001663469 5:173413489-173413511 GTGGGGGGGTTGGTGTGGAGGGG No data
1001663451_1001663459 -3 Left 1001663451 5:173413451-173413473 CCGGCAACAGCAAATACACTTTC No data
Right 1001663459 5:173413471-173413493 TTCCTGGGTGAGGGGATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001663451 Original CRISPR GAAAGTGTATTTGCTGTTGC CGG (reversed) Intergenic
No off target data available for this crispr