ID: 1001663463

View in Genome Browser
Species Human (GRCh38)
Location 5:173413474-173413496
Sequence CTGGGTGAGGGGATGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001663451_1001663463 0 Left 1001663451 5:173413451-173413473 CCGGCAACAGCAAATACACTTTC No data
Right 1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001663463 Original CRISPR CTGGGTGAGGGGATGGTGGG GGG Intergenic
No off target data available for this crispr