ID: 1001664344

View in Genome Browser
Species Human (GRCh38)
Location 5:173420343-173420365
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001664337_1001664344 26 Left 1001664337 5:173420294-173420316 CCAGAACAAAGAGTCGTATTCGT No data
Right 1001664344 5:173420343-173420365 AAGCTGAGCAGCCCTCGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001664344 Original CRISPR AAGCTGAGCAGCCCTCGCTC AGG Intergenic
No off target data available for this crispr