ID: 1001664511

View in Genome Browser
Species Human (GRCh38)
Location 5:173421392-173421414
Sequence CAGTACCAGCAGACCCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001664511_1001664520 19 Left 1001664511 5:173421392-173421414 CCTCTCTGGGTCTGCTGGTACTG No data
Right 1001664520 5:173421434-173421456 CAGTACTCAAGGGAGCCTCTGGG No data
1001664511_1001664515 9 Left 1001664511 5:173421392-173421414 CCTCTCTGGGTCTGCTGGTACTG No data
Right 1001664515 5:173421424-173421446 GTCTCCCAACCAGTACTCAAGGG No data
1001664511_1001664514 8 Left 1001664511 5:173421392-173421414 CCTCTCTGGGTCTGCTGGTACTG No data
Right 1001664514 5:173421423-173421445 TGTCTCCCAACCAGTACTCAAGG No data
1001664511_1001664519 18 Left 1001664511 5:173421392-173421414 CCTCTCTGGGTCTGCTGGTACTG No data
Right 1001664519 5:173421433-173421455 CCAGTACTCAAGGGAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001664511 Original CRISPR CAGTACCAGCAGACCCAGAG AGG (reversed) Intergenic
No off target data available for this crispr