ID: 1001670368

View in Genome Browser
Species Human (GRCh38)
Location 5:173468552-173468574
Sequence TATCATCTGCTGATAGTCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001670366_1001670368 3 Left 1001670366 5:173468526-173468548 CCTGTTAGTCAAATGATTCCTTT No data
Right 1001670368 5:173468552-173468574 TATCATCTGCTGATAGTCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001670368 Original CRISPR TATCATCTGCTGATAGTCGA AGG Intergenic
No off target data available for this crispr