ID: 1001670554

View in Genome Browser
Species Human (GRCh38)
Location 5:173469875-173469897
Sequence CCATTGCATGGATACGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 65}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001670554_1001670557 -7 Left 1001670554 5:173469875-173469897 CCACAGACGTATCCATGCAATGG 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1001670557 5:173469891-173469913 GCAATGGTCTTCTGTCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001670554 Original CRISPR CCATTGCATGGATACGTCTG TGG (reversed) Intergenic
901685299 1:10940434-10940456 CCAGAGCATGGCTAAGTCTGAGG + Intergenic
912459763 1:109822816-109822838 CCATTGCATGCAGAGGTCCGAGG + Intergenic
922238978 1:223743156-223743178 CCATGACATGGATAAGTGTGAGG - Intronic
924108850 1:240677361-240677383 GCATTGCATGGAGAAGTTTGAGG - Intergenic
1066596149 10:37052112-37052134 CCATTCTATGGATGAGTCTGTGG - Intergenic
1067390924 10:45862936-45862958 CCATTCCATGGAAAAGTCAGAGG + Intergenic
1067500546 10:46800913-46800935 CCATTCCATGGAAAAGTCAGAGG - Intergenic
1067594039 10:47538989-47539011 CCATTCCATGGAAAAGTCAGAGG + Intronic
1067641149 10:48047102-48047124 CCATTCCATGGAAAAGTCAGAGG + Intergenic
1067872355 10:49973170-49973192 CCATTCCATGGAAAAGTCAGAGG - Exonic
1070138111 10:73713154-73713176 CCATTCCATGGAAAAGTCAGAGG + Intergenic
1070678645 10:78433444-78433466 CCCTTGTATGGATAGGCCTGGGG - Intergenic
1071403149 10:85298216-85298238 CCCTTGCCTGGATAAGACTGTGG + Intergenic
1080413470 11:32048161-32048183 CCATTGCAAGGATAAGTGTCAGG + Intronic
1082211600 11:49509620-49509642 CCATTGCTTGGATCCATCAGCGG + Intergenic
1090085274 11:123645002-123645024 CCAAATCATGGATAAGTCTGGGG + Intronic
1091674997 12:2482675-2482697 TCACTGCTTGGATACCTCTGAGG + Intronic
1100698733 12:97123602-97123624 CCAGTGCATGGATACATAAGGGG - Intergenic
1113399101 13:109975059-109975081 CCACTGCAGGGAGACGTGTGGGG - Intergenic
1115212956 14:30986175-30986197 TCACTGCATGGATGCGTGTGAGG + Intronic
1116491752 14:45511840-45511862 CCATTGTATGGATACATCACAGG + Intergenic
1116743663 14:48790630-48790652 GCATTGCAAAGATAAGTCTGGGG - Intergenic
1120566355 14:86063278-86063300 CCATTGCATGGAGAAGCCTATGG - Intergenic
1126379804 15:48034707-48034729 GCATGGCAGGGATAAGTCTGGGG + Intergenic
1139385047 16:66562007-66562029 CCATTGCATAGAGATGTCTGTGG + Intronic
1146406443 17:32542822-32542844 CCCTTGCTTGGATACCTCTGGGG - Intronic
1147595904 17:41716990-41717012 CCATTGCTTATATACATCTGGGG + Intergenic
1147837679 17:43346581-43346603 CCAGTGCGTGGAGAAGTCTGGGG - Intergenic
1148480083 17:47954313-47954335 GCAATGCATGGTTACCTCTGTGG - Intronic
1148682029 17:49479651-49479673 CCACTACATGGATTCGTGTGAGG - Intergenic
1149406207 17:56353999-56354021 CCATTGCAAGGATTCTTCTGAGG + Exonic
1150819158 17:68421141-68421163 CGAGTCCATGGATAAGTCTGTGG + Exonic
1151369329 17:73637991-73638013 CCATTCCATGGATGCATCTGCGG + Intronic
1157303263 18:46496475-46496497 CCCTTGCATAGACACGTATGAGG - Intronic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1165567747 19:36746132-36746154 TCACTGCATGGTTACGTCAGAGG - Exonic
926870790 2:17413864-17413886 CCAATACAGGGATACGTTTGAGG - Intergenic
927277870 2:21276868-21276890 GCATTCTATGTATACGTCTGTGG + Intergenic
929124279 2:38509097-38509119 CCATTGCATGGAGACAGCTGGGG - Intergenic
934927032 2:98389211-98389233 GCATTGCCTGGATAGTTCTGAGG - Intronic
935495435 2:103775359-103775381 CCATTCCATGCATACATATGGGG - Intergenic
1170533727 20:17319722-17319744 CATTTTCAAGGATACGTCTGTGG - Intronic
949361420 3:3236019-3236041 CAATAGCAAGGATACCTCTGTGG + Intergenic
953480187 3:43244752-43244774 CCATTTCATGGATATATTTGAGG - Intergenic
954357040 3:50090301-50090323 CCATAGCTTGGATACTACTGAGG - Intronic
956054879 3:65288262-65288284 CCATTACATGGATACTTCTTGGG + Intergenic
970471282 4:16381693-16381715 TCATGGCATGGATAAGACTGGGG - Intergenic
974084028 4:57240414-57240436 CCAATGCAGGGATACATCAGGGG - Intergenic
977854253 4:101869395-101869417 CTATTGGATGGATACTTCTTTGG + Intronic
978488971 4:109290210-109290232 CCCTTGAATGGAGAAGTCTGAGG - Intronic
984411220 4:179400598-179400620 CCATTGCATTGAAACGTGGGTGG + Intergenic
986983921 5:13479297-13479319 AAATTGCATGGATAGGTTTGTGG + Intergenic
998772857 5:145566129-145566151 CCATTGCAAGAACACTTCTGAGG - Intronic
1001670554 5:173469875-173469897 CCATTGCATGGATACGTCTGTGG - Intergenic
1002915030 6:1522249-1522271 CCATTCCATAGATATGTCTCAGG + Intergenic
1003134258 6:3421349-3421371 TCATTGCATAGAGACCTCTGTGG - Intronic
1005017233 6:21385861-21385883 CCATTGCACGGATACATTTGAGG - Intergenic
1006361833 6:33591062-33591084 CCCTTGCATAGAGACATCTGGGG + Intergenic
1013573398 6:111453405-111453427 CCATTTCATGGAGACGTAGGGGG + Intronic
1035752931 8:2008527-2008549 CCATTGCAAGGAAATTTCTGAGG - Intergenic
1036548369 8:9794093-9794115 CCATTGCTGGGTTAGGTCTGCGG + Intergenic
1047823830 8:128551438-128551460 CCATTCCATGGATAACGCTGAGG - Intergenic
1048100373 8:131344151-131344173 CAATTGCAAGGATACTTCTAGGG + Intergenic
1051339718 9:16100471-16100493 CAATTACATCGATACCTCTGGGG - Intergenic
1053276240 9:36785721-36785743 CCTTTGCATGGATACGTTTATGG + Intergenic
1055369867 9:75586074-75586096 CCTTTGCATGGATAGAGCTGAGG + Intergenic
1056319344 9:85421647-85421669 CCATGGCATGGATATTTCTTAGG + Intergenic
1060679350 9:125547435-125547457 TCATTTCATGGATGCGGCTGAGG - Intronic
1186222128 X:7360840-7360862 CCATTGTATGCACACTTCTGTGG - Intergenic
1187940650 X:24377689-24377711 CCAATGCATGGTTGGGTCTGAGG - Intergenic
1200183815 X:154168783-154168805 CCATTGCATGGAGACGCCGCAGG - Intergenic
1200189469 X:154205911-154205933 CCATTGCATGGAGACGCCGCAGG - Intergenic
1200195222 X:154243720-154243742 CCATTGCATGGAGACGCCGCAGG - Intergenic
1200200874 X:154280841-154280863 CCATTGCATGGAGACGCCGCAGG - Intronic