ID: 1001671653

View in Genome Browser
Species Human (GRCh38)
Location 5:173478692-173478714
Sequence CCCTAGATGCAAAAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001671653_1001671667 25 Left 1001671653 5:173478692-173478714 CCTTCCATCTTTTGCATCTAGGG No data
Right 1001671667 5:173478740-173478762 AACTCCTGCACTGTCTCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001671653 Original CRISPR CCCTAGATGCAAAAGATGGA AGG (reversed) Intergenic
No off target data available for this crispr