ID: 1001672215

View in Genome Browser
Species Human (GRCh38)
Location 5:173483229-173483251
Sequence GACCAAGGTTTAGAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001672215_1001672224 22 Left 1001672215 5:173483229-173483251 CCTTCCAGCTCTAAACCTTGGTC No data
Right 1001672224 5:173483274-173483296 TGGTTCCATCTGATGCAGTCTGG No data
1001672215_1001672221 2 Left 1001672215 5:173483229-173483251 CCTTCCAGCTCTAAACCTTGGTC No data
Right 1001672221 5:173483254-173483276 GGAGGCTCAGAGCCACTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001672215 Original CRISPR GACCAAGGTTTAGAGCTGGA AGG (reversed) Intergenic
No off target data available for this crispr