ID: 1001672401

View in Genome Browser
Species Human (GRCh38)
Location 5:173484875-173484897
Sequence GACCGACCTGTGGCTCCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001672401_1001672404 8 Left 1001672401 5:173484875-173484897 CCAAAGGGAGCCACAGGTCGGTC No data
Right 1001672404 5:173484906-173484928 TCTATGAGATTCAAAGCTCAGGG No data
1001672401_1001672403 7 Left 1001672401 5:173484875-173484897 CCAAAGGGAGCCACAGGTCGGTC No data
Right 1001672403 5:173484905-173484927 ATCTATGAGATTCAAAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001672401 Original CRISPR GACCGACCTGTGGCTCCCTT TGG (reversed) Intergenic
No off target data available for this crispr