ID: 1001678974

View in Genome Browser
Species Human (GRCh38)
Location 5:173542479-173542501
Sequence TCCTGTGTGCTGCACTGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001678974_1001678978 21 Left 1001678974 5:173542479-173542501 CCAGTACAGTGCAGCACACAGGA No data
Right 1001678978 5:173542523-173542545 AGAGCAGAGAAAGCTTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001678974 Original CRISPR TCCTGTGTGCTGCACTGTAC TGG (reversed) Intergenic
No off target data available for this crispr