ID: 1001683034

View in Genome Browser
Species Human (GRCh38)
Location 5:173572703-173572725
Sequence GAGCCAGCCATTGCTCCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001683034_1001683044 20 Left 1001683034 5:173572703-173572725 CCAGGGGGAGCAATGGCTGGCTC No data
Right 1001683044 5:173572746-173572768 GGTGTTGTCATGGGGGGATGTGG No data
1001683034_1001683040 11 Left 1001683034 5:173572703-173572725 CCAGGGGGAGCAATGGCTGGCTC No data
Right 1001683040 5:173572737-173572759 AGAGAGGGAGGTGTTGTCATGGG No data
1001683034_1001683041 12 Left 1001683034 5:173572703-173572725 CCAGGGGGAGCAATGGCTGGCTC No data
Right 1001683041 5:173572738-173572760 GAGAGGGAGGTGTTGTCATGGGG No data
1001683034_1001683038 -1 Left 1001683034 5:173572703-173572725 CCAGGGGGAGCAATGGCTGGCTC No data
Right 1001683038 5:173572725-173572747 CCACAGCTCTAGAGAGAGGGAGG No data
1001683034_1001683043 14 Left 1001683034 5:173572703-173572725 CCAGGGGGAGCAATGGCTGGCTC No data
Right 1001683043 5:173572740-173572762 GAGGGAGGTGTTGTCATGGGGGG No data
1001683034_1001683039 10 Left 1001683034 5:173572703-173572725 CCAGGGGGAGCAATGGCTGGCTC No data
Right 1001683039 5:173572736-173572758 GAGAGAGGGAGGTGTTGTCATGG No data
1001683034_1001683042 13 Left 1001683034 5:173572703-173572725 CCAGGGGGAGCAATGGCTGGCTC No data
Right 1001683042 5:173572739-173572761 AGAGGGAGGTGTTGTCATGGGGG No data
1001683034_1001683045 21 Left 1001683034 5:173572703-173572725 CCAGGGGGAGCAATGGCTGGCTC No data
Right 1001683045 5:173572747-173572769 GTGTTGTCATGGGGGGATGTGGG No data
1001683034_1001683035 -5 Left 1001683034 5:173572703-173572725 CCAGGGGGAGCAATGGCTGGCTC No data
Right 1001683035 5:173572721-173572743 GGCTCCACAGCTCTAGAGAGAGG No data
1001683034_1001683036 -4 Left 1001683034 5:173572703-173572725 CCAGGGGGAGCAATGGCTGGCTC No data
Right 1001683036 5:173572722-173572744 GCTCCACAGCTCTAGAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001683034 Original CRISPR GAGCCAGCCATTGCTCCCCC TGG (reversed) Intergenic
No off target data available for this crispr