ID: 1001683876

View in Genome Browser
Species Human (GRCh38)
Location 5:173578027-173578049
Sequence TGGGCTCCACCCTGGCGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001683876_1001683885 -2 Left 1001683876 5:173578027-173578049 CCTCCCCGCCAGGGTGGAGCCCA No data
Right 1001683885 5:173578048-173578070 CATGGGACCTTGCTTCGTCCTGG No data
1001683876_1001683887 7 Left 1001683876 5:173578027-173578049 CCTCCCCGCCAGGGTGGAGCCCA No data
Right 1001683887 5:173578057-173578079 TTGCTTCGTCCTGGAGCCCCTGG No data
1001683876_1001683892 25 Left 1001683876 5:173578027-173578049 CCTCCCCGCCAGGGTGGAGCCCA No data
Right 1001683892 5:173578075-173578097 CCTGGCTCTGAATCTGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001683876 Original CRISPR TGGGCTCCACCCTGGCGGGG AGG (reversed) Intergenic
No off target data available for this crispr