ID: 1001683887

View in Genome Browser
Species Human (GRCh38)
Location 5:173578057-173578079
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001683873_1001683887 16 Left 1001683873 5:173578018-173578040 CCAATGTCGCCTCCCCGCCAGGG No data
Right 1001683887 5:173578057-173578079 TTGCTTCGTCCTGGAGCCCCTGG No data
1001683877_1001683887 4 Left 1001683877 5:173578030-173578052 CCCCGCCAGGGTGGAGCCCATGG No data
Right 1001683887 5:173578057-173578079 TTGCTTCGTCCTGGAGCCCCTGG No data
1001683879_1001683887 3 Left 1001683879 5:173578031-173578053 CCCGCCAGGGTGGAGCCCATGGG No data
Right 1001683887 5:173578057-173578079 TTGCTTCGTCCTGGAGCCCCTGG No data
1001683876_1001683887 7 Left 1001683876 5:173578027-173578049 CCTCCCCGCCAGGGTGGAGCCCA No data
Right 1001683887 5:173578057-173578079 TTGCTTCGTCCTGGAGCCCCTGG No data
1001683881_1001683887 2 Left 1001683881 5:173578032-173578054 CCGCCAGGGTGGAGCCCATGGGA No data
Right 1001683887 5:173578057-173578079 TTGCTTCGTCCTGGAGCCCCTGG No data
1001683882_1001683887 -1 Left 1001683882 5:173578035-173578057 CCAGGGTGGAGCCCATGGGACCT No data
Right 1001683887 5:173578057-173578079 TTGCTTCGTCCTGGAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001683887 Original CRISPR TTGCTTCGTCCTGGAGCCCC TGG Intergenic
No off target data available for this crispr