ID: 1001683892

View in Genome Browser
Species Human (GRCh38)
Location 5:173578075-173578097
Sequence CCTGGCTCTGAATCTGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001683879_1001683892 21 Left 1001683879 5:173578031-173578053 CCCGCCAGGGTGGAGCCCATGGG No data
Right 1001683892 5:173578075-173578097 CCTGGCTCTGAATCTGAGTCTGG No data
1001683876_1001683892 25 Left 1001683876 5:173578027-173578049 CCTCCCCGCCAGGGTGGAGCCCA No data
Right 1001683892 5:173578075-173578097 CCTGGCTCTGAATCTGAGTCTGG No data
1001683883_1001683892 6 Left 1001683883 5:173578046-173578068 CCCATGGGACCTTGCTTCGTCCT No data
Right 1001683892 5:173578075-173578097 CCTGGCTCTGAATCTGAGTCTGG No data
1001683882_1001683892 17 Left 1001683882 5:173578035-173578057 CCAGGGTGGAGCCCATGGGACCT No data
Right 1001683892 5:173578075-173578097 CCTGGCTCTGAATCTGAGTCTGG No data
1001683886_1001683892 -3 Left 1001683886 5:173578055-173578077 CCTTGCTTCGTCCTGGAGCCCCT No data
Right 1001683892 5:173578075-173578097 CCTGGCTCTGAATCTGAGTCTGG No data
1001683884_1001683892 5 Left 1001683884 5:173578047-173578069 CCATGGGACCTTGCTTCGTCCTG No data
Right 1001683892 5:173578075-173578097 CCTGGCTCTGAATCTGAGTCTGG No data
1001683881_1001683892 20 Left 1001683881 5:173578032-173578054 CCGCCAGGGTGGAGCCCATGGGA No data
Right 1001683892 5:173578075-173578097 CCTGGCTCTGAATCTGAGTCTGG No data
1001683877_1001683892 22 Left 1001683877 5:173578030-173578052 CCCCGCCAGGGTGGAGCCCATGG No data
Right 1001683892 5:173578075-173578097 CCTGGCTCTGAATCTGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001683892 Original CRISPR CCTGGCTCTGAATCTGAGTC TGG Intergenic
No off target data available for this crispr