ID: 1001684694

View in Genome Browser
Species Human (GRCh38)
Location 5:173584645-173584667
Sequence AGTAGTCACAAGCCTGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001684694_1001684700 27 Left 1001684694 5:173584645-173584667 CCCTGGGCAGGCTTGTGACTACT No data
Right 1001684700 5:173584695-173584717 GCTTGTCAGTTTCCAGGCCTGGG No data
1001684694_1001684698 21 Left 1001684694 5:173584645-173584667 CCCTGGGCAGGCTTGTGACTACT No data
Right 1001684698 5:173584689-173584711 AGTGGTGCTTGTCAGTTTCCAGG No data
1001684694_1001684697 3 Left 1001684694 5:173584645-173584667 CCCTGGGCAGGCTTGTGACTACT No data
Right 1001684697 5:173584671-173584693 CCAACAGAATACAGCAGAAGTGG No data
1001684694_1001684699 26 Left 1001684694 5:173584645-173584667 CCCTGGGCAGGCTTGTGACTACT No data
Right 1001684699 5:173584694-173584716 TGCTTGTCAGTTTCCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001684694 Original CRISPR AGTAGTCACAAGCCTGCCCA GGG (reversed) Intergenic
No off target data available for this crispr