ID: 1001684696

View in Genome Browser
Species Human (GRCh38)
Location 5:173584671-173584693
Sequence CCACTTCTGCTGTATTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001684696_1001684704 16 Left 1001684696 5:173584671-173584693 CCAACAGAATACAGCAGAAGTGG No data
Right 1001684704 5:173584710-173584732 GGCCTGGGCTTTTTAGAGGGTGG No data
1001684696_1001684703 13 Left 1001684696 5:173584671-173584693 CCAACAGAATACAGCAGAAGTGG No data
Right 1001684703 5:173584707-173584729 CCAGGCCTGGGCTTTTTAGAGGG No data
1001684696_1001684701 12 Left 1001684696 5:173584671-173584693 CCAACAGAATACAGCAGAAGTGG No data
Right 1001684701 5:173584706-173584728 TCCAGGCCTGGGCTTTTTAGAGG No data
1001684696_1001684700 1 Left 1001684696 5:173584671-173584693 CCAACAGAATACAGCAGAAGTGG No data
Right 1001684700 5:173584695-173584717 GCTTGTCAGTTTCCAGGCCTGGG No data
1001684696_1001684698 -5 Left 1001684696 5:173584671-173584693 CCAACAGAATACAGCAGAAGTGG No data
Right 1001684698 5:173584689-173584711 AGTGGTGCTTGTCAGTTTCCAGG No data
1001684696_1001684699 0 Left 1001684696 5:173584671-173584693 CCAACAGAATACAGCAGAAGTGG No data
Right 1001684699 5:173584694-173584716 TGCTTGTCAGTTTCCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001684696 Original CRISPR CCACTTCTGCTGTATTCTGT TGG (reversed) Intergenic
No off target data available for this crispr