ID: 1001684697

View in Genome Browser
Species Human (GRCh38)
Location 5:173584671-173584693
Sequence CCAACAGAATACAGCAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001684686_1001684697 30 Left 1001684686 5:173584618-173584640 CCCTGCATGGAGAGGTGAGGTGG No data
Right 1001684697 5:173584671-173584693 CCAACAGAATACAGCAGAAGTGG No data
1001684694_1001684697 3 Left 1001684694 5:173584645-173584667 CCCTGGGCAGGCTTGTGACTACT No data
Right 1001684697 5:173584671-173584693 CCAACAGAATACAGCAGAAGTGG No data
1001684688_1001684697 29 Left 1001684688 5:173584619-173584641 CCTGCATGGAGAGGTGAGGTGGG No data
Right 1001684697 5:173584671-173584693 CCAACAGAATACAGCAGAAGTGG No data
1001684695_1001684697 2 Left 1001684695 5:173584646-173584668 CCTGGGCAGGCTTGTGACTACTT No data
Right 1001684697 5:173584671-173584693 CCAACAGAATACAGCAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001684697 Original CRISPR CCAACAGAATACAGCAGAAG TGG Intergenic
No off target data available for this crispr