ID: 1001684700

View in Genome Browser
Species Human (GRCh38)
Location 5:173584695-173584717
Sequence GCTTGTCAGTTTCCAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001684694_1001684700 27 Left 1001684694 5:173584645-173584667 CCCTGGGCAGGCTTGTGACTACT No data
Right 1001684700 5:173584695-173584717 GCTTGTCAGTTTCCAGGCCTGGG No data
1001684696_1001684700 1 Left 1001684696 5:173584671-173584693 CCAACAGAATACAGCAGAAGTGG No data
Right 1001684700 5:173584695-173584717 GCTTGTCAGTTTCCAGGCCTGGG No data
1001684695_1001684700 26 Left 1001684695 5:173584646-173584668 CCTGGGCAGGCTTGTGACTACTT No data
Right 1001684700 5:173584695-173584717 GCTTGTCAGTTTCCAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001684700 Original CRISPR GCTTGTCAGTTTCCAGGCCT GGG Intergenic
No off target data available for this crispr