ID: 1001685678

View in Genome Browser
Species Human (GRCh38)
Location 5:173593179-173593201
Sequence TACCCAAGGCTCACAGTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001685678_1001685681 -6 Left 1001685678 5:173593179-173593201 CCACTCACTGTGAGCCTTGGGTA No data
Right 1001685681 5:173593196-173593218 TGGGTAGGATATTTCCCTCTTGG No data
1001685678_1001685685 21 Left 1001685678 5:173593179-173593201 CCACTCACTGTGAGCCTTGGGTA No data
Right 1001685685 5:173593223-173593245 TCACTTTCCTCACCTGCAAATGG No data
1001685678_1001685686 22 Left 1001685678 5:173593179-173593201 CCACTCACTGTGAGCCTTGGGTA No data
Right 1001685686 5:173593224-173593246 CACTTTCCTCACCTGCAAATGGG No data
1001685678_1001685687 23 Left 1001685678 5:173593179-173593201 CCACTCACTGTGAGCCTTGGGTA No data
Right 1001685687 5:173593225-173593247 ACTTTCCTCACCTGCAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001685678 Original CRISPR TACCCAAGGCTCACAGTGAG TGG (reversed) Intergenic
No off target data available for this crispr