ID: 1001688304

View in Genome Browser
Species Human (GRCh38)
Location 5:173612694-173612716
Sequence TCACCATTACACTTTAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001688301_1001688304 -8 Left 1001688301 5:173612679-173612701 CCTTCCTGAAAGCTGTCACCATT 0: 1
1: 0
2: 1
3: 31
4: 267
Right 1001688304 5:173612694-173612716 TCACCATTACACTTTAGAGGTGG 0: 1
1: 0
2: 0
3: 18
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001688304 Original CRISPR TCACCATTACACTTTAGAGG TGG Intronic
902611178 1:17597922-17597944 TCACCTTTACAGTTTACATGGGG + Intronic
904692816 1:32307200-32307222 TCACCATTGCACTCTAGCGTGGG + Intronic
905780059 1:40700981-40701003 TCAGAATTACACTTTAAACGTGG + Intronic
907761986 1:57369734-57369756 TGACCTTCACATTTTAGAGGAGG - Intronic
910479587 1:87643792-87643814 TCACCATTATAGTTTTAAGGTGG - Intergenic
910921168 1:92348844-92348866 TCACAATTACATTTTAGAGAAGG + Intronic
911095930 1:94055080-94055102 TTACCTTTACCCTATAGAGGAGG + Intronic
917560012 1:176141171-176141193 ACACCATTACACTTTCAATGGGG + Intronic
924789223 1:247228776-247228798 TCAACTTTAAACTATAGAGGAGG + Intergenic
1064627756 10:17278735-17278757 TCACAATTACACTTTATTGCAGG + Intergenic
1065346017 10:24748899-24748921 ACACTATTACCCTTTAGGGGTGG - Intergenic
1065382747 10:25106267-25106289 TCACCATTGCAATCTAGAGGTGG - Intergenic
1068833401 10:61523585-61523607 TCACCATCACACTTTAGCCTAGG + Intergenic
1071078472 10:81782468-81782490 TCACCATTACAATGAACAGGAGG + Intergenic
1072643022 10:97227833-97227855 TCACCAATAAGCTTTAGAGCAGG - Intronic
1078438301 11:11343813-11343835 TCACCATTTCACCTTAGAGTGGG + Intronic
1079436883 11:20463815-20463837 TCTCCATTATACTTTGGAGAAGG - Intronic
1082278462 11:50246237-50246259 TCTCCATTTCTCTTTAGGGGAGG - Intergenic
1091129759 11:133135633-133135655 TCTCCATAACAATTTAGAGTAGG + Intronic
1092210511 12:6643362-6643384 TTACCAGTCCACTTTAAAGGAGG - Intronic
1092807069 12:12234242-12234264 GCACCATTACACTTTAGCGTGGG + Intronic
1094725877 12:33115700-33115722 TCAGCATTACATTTTAGATGTGG - Intergenic
1096046150 12:48564110-48564132 AGACCCTTATACTTTAGAGGGGG - Intergenic
1098850590 12:75591600-75591622 TCACCATTACATTTTACAGTTGG - Intergenic
1100340290 12:93672605-93672627 ACACCATAAGACTTTAGTGGTGG - Intergenic
1102127502 12:110496200-110496222 TCACCTTGACACTTTAAAGTTGG - Exonic
1102313752 12:111868756-111868778 TCTCCATTACAATTAAGAGTCGG - Exonic
1102664140 12:114555528-114555550 TCACCCTTACACCTTTGAGCTGG - Intergenic
1107078279 13:36346630-36346652 TCACCGTAACACTCTAGAAGGGG + Exonic
1108758377 13:53532024-53532046 TCACCATGACACTTTTGAGAAGG - Intergenic
1119646856 14:76354445-76354467 TCACCATTGCACTCTGAAGGGGG + Intronic
1121015808 14:90548335-90548357 CCACCATTACCCTTTGCAGGGGG + Intronic
1123689783 15:22828385-22828407 TCACCAGTACAATTGTGAGGTGG - Exonic
1125350221 15:38759032-38759054 TTACCTTTACATTTTACAGGTGG + Intergenic
1125713082 15:41803084-41803106 TCACCCTCATATTTTAGAGGAGG + Intronic
1128566902 15:68706750-68706772 ACACCACTACACTTTAGTGTGGG - Intronic
1129076586 15:73002222-73002244 TCACCACTACACTTTAGCCTGGG - Intergenic
1137825584 16:51491778-51491800 TAACCATTTCATTTTAGAGAAGG + Intergenic
1140126082 16:72120067-72120089 GGACCATTACACTGTGGAGGTGG + Exonic
1140352698 16:74278014-74278036 TCAGCATTACACTTTGTGGGAGG + Intergenic
1140579944 16:76218182-76218204 CCACCATCCCAGTTTAGAGGTGG - Intergenic
1143304075 17:5932338-5932360 GCACCATTACACTTTAGCCTGGG - Intronic
1147906528 17:43826876-43826898 ACACCACTACACTCTAGAGTGGG - Intronic
1150055424 17:62010507-62010529 TCACCATTATAATTTAAGGGTGG - Intronic
1159814388 18:73054843-73054865 TCACCATTGCACTTTAGCCTGGG + Intergenic
1160160327 18:76465808-76465830 TGACCATCACACTTCTGAGGAGG - Intronic
1163438673 19:17310473-17310495 TCACCATCCCACTTTTCAGGTGG - Intronic
1167171466 19:47835035-47835057 GCACCATTGCACTTCAGAGTGGG - Intronic
1168614223 19:57824963-57824985 TCACCATTGCACTCCAGATGGGG - Intronic
930390571 2:50756289-50756311 TCACCACTATACTTGTGAGGTGG - Intronic
930728663 2:54707729-54707751 TGGCCATAACATTTTAGAGGTGG + Intergenic
930898308 2:56472321-56472343 TGAAAATTACAGTTTAGAGGAGG - Intergenic
931072532 2:58669299-58669321 TCACCATTTCATTTTACTGGAGG - Intergenic
931251319 2:60532891-60532913 TCACCATTAAATTTTGGTGGTGG - Intronic
931731065 2:65153837-65153859 TCACAATTATACTTTAGAGCAGG - Intergenic
933265097 2:80173152-80173174 TTTCCATTACACATTAAAGGTGG - Intronic
936376043 2:111942261-111942283 TCACAAATCCACTTTAGAAGAGG - Intronic
936842322 2:116786554-116786576 TCACCATAAAACTTGAGAAGTGG - Intergenic
938750440 2:134323490-134323512 TCTCCATTACTCTTTAGAGTTGG - Intronic
938896541 2:135757555-135757577 TCACCTTTACCCTTTAGAATGGG + Intronic
946262699 2:218508230-218508252 TCTCCATTACCCTTTAGACCTGG + Intronic
946776269 2:223144861-223144883 ACATCATTACCCTTTAGAGGAGG + Intronic
947453157 2:230226717-230226739 ACACCATTACACTTTAGCCTGGG + Intronic
1171078127 20:22149706-22149728 TCACTATTAGAACTTAGAGGAGG + Intergenic
1174649216 20:52110546-52110568 TCTCCTTCACACTTGAGAGGTGG + Intronic
1177202809 21:17977034-17977056 GCTCCATAACACTTTAAAGGAGG + Intronic
1183988984 22:41585373-41585395 CCACAATCACACTTTAGAGTAGG - Intronic
952531391 3:34265628-34265650 TCACCTTTTCATTTTAGAGAAGG + Intergenic
953161633 3:40425853-40425875 TCACCATTTCACTTTAGCCTGGG + Intronic
954095327 3:48321769-48321791 GCACCATTACACTTCAGCGTGGG + Intronic
954558179 3:51534674-51534696 TCAACATTCCACTTCAAAGGTGG - Intergenic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
957094730 3:75768185-75768207 TCAGCATTTCTCTTTAGATGGGG - Intronic
964829458 3:160867443-160867465 ACACCATAACAGTATAGAGGAGG - Intronic
965426211 3:168526964-168526986 TCCCCATTACTCCTTAGAGGTGG + Intergenic
965720625 3:171657205-171657227 TCACAACTACACTTGAGAGTAGG - Intronic
965930177 3:174032662-174032684 TCACCATAAGATTTTAGTGGAGG - Intronic
966574660 3:181486569-181486591 TCACTATAACACTTTAAAAGAGG + Intergenic
967567935 3:190993183-190993205 TCAGCATTCCACTCAAGAGGTGG - Intergenic
970443768 4:16107407-16107429 CCACCATGAGACTGTAGAGGAGG - Intergenic
970931915 4:21521991-21522013 TCCCCATCACCCTCTAGAGGAGG - Intronic
971859494 4:32086428-32086450 GGACAATTACACTTTAGAAGAGG + Intergenic
979346807 4:119597248-119597270 TTTCCATTACACTTTAGATTGGG + Intronic
980065135 4:128179442-128179464 CCAACATGACACTCTAGAGGGGG - Exonic
990660021 5:58002863-58002885 TCACCATTTCATTTTAGATATGG + Intergenic
990777671 5:59321299-59321321 TTATCATTACACATTATAGGAGG - Intronic
993240507 5:85378147-85378169 TCACCATTTCACTCTAGACTGGG - Intergenic
996160332 5:120154138-120154160 CCAACATTACAATTTAGAGGAGG + Intergenic
999481422 5:151951619-151951641 TCACCATCTCACTTTACAGGTGG + Intergenic
1001688304 5:173612694-173612716 TCACCATTACACTTTAGAGGTGG + Intronic
1006220855 6:32489951-32489973 CCACCATTTCACTTTAACGGTGG - Intergenic
1008762420 6:54868619-54868641 TCACCATTATACTATAGGGCAGG + Intronic
1013088137 6:106874332-106874354 TCACCATTACAGTATTGATGTGG + Intergenic
1020950924 7:14676054-14676076 TCACTTTTACACTTTATAGGTGG - Intronic
1021250745 7:18322610-18322632 TCACCAGCATACTGTAGAGGTGG - Intronic
1025093359 7:56080740-56080762 TCTCCATTTCTCTTTAGGGGAGG - Exonic
1030842657 7:114375299-114375321 ACACCATTATACTCTCGAGGAGG - Intronic
1039925377 8:41926849-41926871 CCAACATTTCACTTTAGAGCTGG - Intergenic
1046570668 8:115961700-115961722 TCAACATTAGACTCTAAAGGTGG - Intergenic
1050289675 9:4140641-4140663 TAACAATTACAGTCTAGAGGAGG - Intronic
1050416184 9:5419752-5419774 TAACCCTTACACTTTACAGCGGG + Intronic
1050446800 9:5731892-5731914 TAACCATTACACTATAAAGAAGG + Intronic
1052191312 9:25666231-25666253 TCACCATTTAACTTTAAAGGAGG - Intergenic
1057067556 9:92069726-92069748 GCACCATTATACTTTGAAGGAGG - Intronic
1059128071 9:111713523-111713545 TTACCATTACAGTTTTGTGGGGG + Intronic
1186724771 X:12345288-12345310 TCACCATCACACATTACAGGAGG - Intronic
1192632584 X:72788955-72788977 TCACCATTGCGCTTTAGAGTTGG - Intronic
1192649125 X:72931846-72931868 TCACCATTGCGCTTTAGAGTTGG + Intronic