ID: 1001688457

View in Genome Browser
Species Human (GRCh38)
Location 5:173614155-173614177
Sequence GAACGAACAAACTCTCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001688457_1001688458 -10 Left 1001688457 5:173614155-173614177 CCTCTGGGAGAGTTTGTTCGTTC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1001688458 5:173614168-173614190 TTGTTCGTTCAATCCTTCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001688457 Original CRISPR GAACGAACAAACTCTCCCAG AGG (reversed) Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
901941197 1:12663224-12663246 AAACTAAGAAACTCACCCAGAGG - Intronic
902501293 1:16913513-16913535 GAACGAACATACTGTCACAGTGG + Intronic
907943593 1:59111923-59111945 AAACAAACAAACTAACCCAGAGG - Intergenic
914783768 1:150809666-150809688 GAACCAACATAGTCTCCTAGAGG + Intergenic
915863834 1:159477037-159477059 GAAGGCACAAATTCTCCCAAAGG - Intergenic
1063367652 10:5500819-5500841 GAATGTATAAACTTTCCCAGGGG - Intergenic
1064845980 10:19653620-19653642 TAAGAAACAAAGTCTCCCAGAGG - Intronic
1065370913 10:24985116-24985138 GAGCAAACAAATACTCCCAGTGG - Intronic
1069377538 10:67809036-67809058 GACCCAACAAGCCCTCCCAGAGG + Intronic
1069646961 10:70007353-70007375 GAACAAAGAAAAACTCCCAGCGG - Intergenic
1075596805 10:123737775-123737797 GAACTGAGAAACTCTCCCTGAGG + Intronic
1077540948 11:3146257-3146279 GAAAGAACAGACTTCCCCAGAGG - Intronic
1079416063 11:20237808-20237830 GGCAGAACAACCTCTCCCAGTGG + Intergenic
1081868356 11:46371983-46372005 GAGGGAACAAAGTCACCCAGGGG + Intronic
1083797314 11:65024671-65024693 GAACAGATAAGCTCTCCCAGGGG + Intronic
1085716439 11:78877667-78877689 GAAACAACACACTCTCCTAGGGG - Intronic
1093853233 12:24066907-24066929 GAGAGAACTAACTCTACCAGTGG + Intergenic
1094632058 12:32185489-32185511 GAAGGAACATCCTCTCCCTGAGG + Intronic
1100055278 12:90501919-90501941 GAACTAATTAACTCTCCCAAAGG - Intergenic
1101341770 12:103848403-103848425 TAACGAACTATCCCTCCCAGGGG - Intergenic
1104191615 12:126487093-126487115 TAACTAACAATCTCTCCCAGAGG + Intergenic
1104527798 12:129540445-129540467 GAATGAACAAACACACCCAGAGG - Intronic
1110242883 13:73288378-73288400 GAAAGAAGAAAATCTTCCAGAGG - Intergenic
1112384765 13:98929194-98929216 GAAAAAACAAACACTCCAAGGGG + Intronic
1115310198 14:31971742-31971764 GGACAAAAAAACTCTGCCAGTGG - Intergenic
1119656024 14:76417778-76417800 GAAAGAACAAGCCTTCCCAGAGG + Intronic
1119935348 14:78587167-78587189 CAAAGAACAAACACTCCCATGGG - Intronic
1125638494 15:41209434-41209456 GAAAGAAAAAAATCTACCAGTGG + Intronic
1129180139 15:73869022-73869044 GAATGAGCAGAGTCTCCCAGTGG - Intergenic
1130977591 15:88789260-88789282 GAACAAAGAAACCCACCCAGAGG - Intergenic
1131432815 15:92400366-92400388 GAAGGAACAAACTCTGACCGAGG + Intronic
1135926402 16:26697683-26697705 AAGTGAAGAAACTCTCCCAGTGG + Intergenic
1145744905 17:27310282-27310304 GACACAACAAAATCTCCCAGGGG - Intronic
1157188768 18:45562776-45562798 GAAGGAAAAAATTCTCCCTGGGG + Intronic
1160094339 18:75857820-75857842 ACACGTACCAACTCTCCCAGAGG + Intergenic
1160992827 19:1867178-1867200 CAAAGAACACAGTCTCCCAGAGG + Intergenic
1162085967 19:8249307-8249329 GAACGAACAAACTTTCTGAGTGG + Intronic
1162809610 19:13155965-13155987 GACCCACCCAACTCTCCCAGGGG + Intergenic
1167770872 19:51516738-51516760 GAAAGAAGAAATTCTCCCTGTGG + Intergenic
926939609 2:18120710-18120732 CAACAAAAAAGCTCTCCCAGGGG + Intronic
928318754 2:30266716-30266738 GAATGCACCACCTCTCCCAGGGG + Intronic
929059078 2:37904961-37904983 CAATGAACAACATCTCCCAGTGG + Intergenic
930088128 2:47512746-47512768 CAACCAACAGGCTCTCCCAGTGG - Intronic
930375560 2:50561577-50561599 CAAGGAACAAACTCTGCCATAGG + Intronic
930692066 2:54374445-54374467 TAAAGAACAAACTATCTCAGGGG + Intronic
933288969 2:80415291-80415313 GAACTATCAAAGACTCCCAGGGG - Intronic
942699417 2:178687365-178687387 GAACCAACAAACTATTCCATTGG - Intronic
944986170 2:205179994-205180016 GAAGAGACAAAATCTCCCAGTGG - Intronic
1169877553 20:10314523-10314545 GACCAAACAGACTCTCCAAGGGG + Intergenic
1173035249 20:39402890-39402912 TAAAGAAAAAATTCTCCCAGAGG + Intergenic
1175603504 20:60294230-60294252 GGAGGAACAAGCACTCCCAGAGG - Intergenic
1176517605 21:7797762-7797784 CAAAGACCCAACTCTCCCAGAGG + Intergenic
1178296532 21:31414946-31414968 GACCACACAAACTTTCCCAGGGG - Intronic
1178651633 21:34427774-34427796 CAAAGACCCAACTCTCCCAGAGG + Intergenic
1179457702 21:41510169-41510191 GAATGAACAACCACTCCAAGAGG - Intronic
954527312 3:51283530-51283552 GAACAGACAAACTCTTTCAGTGG + Intronic
964680149 3:159329303-159329325 GCAGGAACAAACTGTCCCACAGG - Intronic
965453685 3:168870756-168870778 GAAGGAACAAACTTTGCCATAGG - Intergenic
971778390 4:30998033-30998055 GAAGTTACAAACTCTGCCAGGGG + Intronic
981477104 4:145198182-145198204 GAACCAAAAAGCTCTTCCAGTGG + Intergenic
983937752 4:173514722-173514744 AAACAAACAAACTCTACCAAAGG + Intergenic
986060076 5:4179736-4179758 CACTGAACAAACTCTCCCAGTGG + Intergenic
990216691 5:53540818-53540840 GAAAGAACAAACTCTCCTCAGGG + Intergenic
992082349 5:73246993-73247015 GTAAGAGCCAACTCTCCCAGAGG + Intergenic
997531033 5:134581440-134581462 GAACAACCAAACTCTGCCAGGGG + Exonic
999649030 5:153747457-153747479 GAACATCCAAACTCTCTCAGGGG + Intronic
1000050136 5:157555822-157555844 CAAGGAACAGATTCTCCCAGAGG - Intronic
1001688457 5:173614155-173614177 GAACGAACAAACTCTCCCAGAGG - Intronic
1002802803 6:542167-542189 GAAGGAACAAAGCATCCCAGAGG - Intronic
1003258009 6:4490710-4490732 GAAAGAACAGACACTCCCAGAGG + Intergenic
1003573309 6:7270068-7270090 GATCACACAAACTCTCCCTGGGG + Intronic
1011661932 6:89602287-89602309 GAAGGATGAAACACTCCCAGAGG - Intronic
1013500498 6:110744579-110744601 GAATGAAAAAATTCTACCAGTGG - Intronic
1019257093 7:59423-59445 GAAGGAACTGCCTCTCCCAGGGG - Intergenic
1019861621 7:3664134-3664156 GAAAGAAAAATATCTCCCAGTGG - Intronic
1023158874 7:37278558-37278580 GAAGGAACAAATTCTACCTGTGG + Intronic
1025238126 7:57248630-57248652 ACAGGGACAAACTCTCCCAGGGG + Intergenic
1026739695 7:72971045-72971067 GAACAAAGAAACATTCCCAGTGG - Intergenic
1026790725 7:73329669-73329691 GAACAAAGAAACATTCCCAGTGG - Intronic
1027104038 7:75394025-75394047 GAACAAAGAAACATTCCCAGTGG + Intergenic
1031330975 7:120464168-120464190 GCACGAACAGACTCACCGAGAGG - Intronic
1033516568 7:142112412-142112434 GAAAGAAAAAAGTCTCCCTGTGG + Intronic
1048024277 8:130570209-130570231 GAACTGACAAACTTTCCCAGAGG - Intergenic
1059470752 9:114503534-114503556 GAAAGGACAAACACTCTCAGGGG + Intronic
1059982835 9:119792183-119792205 GAAGGAAAAAAGTCTCCCAAAGG - Intergenic
1187756745 X:22536096-22536118 CAAAGAACAAACTCTTCCTGCGG + Intergenic
1191861895 X:65672406-65672428 GAACCAACAGACTATCCCAAAGG - Intronic
1195637781 X:107137206-107137228 AAACAAACAAAAACTCCCAGAGG + Intronic
1201401053 Y:13604360-13604382 GAACTTGCACACTCTCCCAGAGG - Intergenic