ID: 1001688529

View in Genome Browser
Species Human (GRCh38)
Location 5:173614789-173614811
Sequence ACGTATCCCCTGAGGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001688529_1001688537 -5 Left 1001688529 5:173614789-173614811 CCCTCCCCCCTCAGGGGATACGT 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1001688537 5:173614807-173614829 TACGTTCCAAGATCCCCAGTGGG 0: 2
1: 5
2: 22
3: 61
4: 143
1001688529_1001688542 11 Left 1001688529 5:173614789-173614811 CCCTCCCCCCTCAGGGGATACGT 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1001688542 5:173614823-173614845 CAGTGGGTGCCTGAAACCTCAGG 0: 1
1: 1
2: 21
3: 52
4: 279
1001688529_1001688536 -6 Left 1001688529 5:173614789-173614811 CCCTCCCCCCTCAGGGGATACGT 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1001688536 5:173614806-173614828 ATACGTTCCAAGATCCCCAGTGG 0: 7
1: 65
2: 398
3: 623
4: 750

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001688529 Original CRISPR ACGTATCCCCTGAGGGGGGA GGG (reversed) Intronic
901214587 1:7548617-7548639 AGGTATCCCCTTAGGGGTGGAGG + Intronic
902578585 1:17394178-17394200 AGGTGGCCTCTGAGGGGGGAGGG + Intronic
903557285 1:24203081-24203103 ATGTATGCCCTGGCGGGGGATGG - Intergenic
908135086 1:61123677-61123699 ACAAATCCAGTGAGGGGGGAAGG + Intronic
917392857 1:174558038-174558060 CCTTATCCCCTGAAGGGGAATGG + Intronic
919105154 1:193140393-193140415 ACATATCCCCAGAGGGTGGATGG - Intronic
921157411 1:212449392-212449414 ACGTTTCCTCTGAGAGGGCAGGG - Intergenic
921463830 1:215461658-215461680 ACATATCCCCTGATGGAGGAGGG - Intergenic
922436720 1:225614621-225614643 ACCTATCTCCTGGGAGGGGAAGG - Intronic
1069773946 10:70916127-70916149 ACGTATCCCCTGAGCAGACAGGG - Intergenic
1074866954 10:117550158-117550180 TCGTACCCCCAGAAGGGGGAAGG - Intergenic
1075529978 10:123220832-123220854 AAGTATCTCCTGAGGTGTGATGG - Intergenic
1076883130 10:133249233-133249255 TCCTGTCCCCTGAGTGGGGAGGG + Intergenic
1078014059 11:7597479-7597501 ACGGCTCCCCTGAGGTGGGGAGG + Intronic
1084961939 11:72721432-72721454 ACGAATCCCCAGAGGGGTGTAGG + Intronic
1085318713 11:75561799-75561821 ACGTCTCCCCTGAGAGGGAGGGG + Intergenic
1086941586 11:92803771-92803793 ACATATCCCCACAGAGGGGAAGG + Intronic
1087661509 11:100994141-100994163 AGGTATCCACCGAGGGGAGAGGG + Intergenic
1091453215 12:586603-586625 ACGCATGCCCTGTGGGCGGATGG - Intronic
1094299480 12:28946240-28946262 ACAGATTCCCTGAGGTGGGATGG - Intergenic
1095982013 12:47979342-47979364 ACCTATCCCCTGAGGGTGGCTGG - Intronic
1098777434 12:74638539-74638561 ATGTATACCCTGAAGTGGGATGG - Intergenic
1102149288 12:110677652-110677674 ACGGATCCCCTGGGGCAGGAAGG - Intronic
1113575348 13:111391284-111391306 ACGTACCCCCTGAGGATAGAGGG - Intergenic
1114073178 14:19131727-19131749 CCCCAACCCCTGAGGGGGGAGGG + Intergenic
1114089088 14:19268256-19268278 CCCCAACCCCTGAGGGGGGAGGG - Intergenic
1118380170 14:65211647-65211669 AGGTATCCACTGGGGGGGGGGGG + Intergenic
1121281494 14:92702377-92702399 AGGTATCCCCTGTGGGGTAAGGG + Intergenic
1121435829 14:93918799-93918821 ATGTCTTCCCTGAGGGAGGATGG - Intergenic
1122027321 14:98887194-98887216 ACAGGTCCCCTGAGGAGGGAAGG + Intergenic
1126133427 15:45367007-45367029 ACATATCCCCTGAGGATGAAGGG + Intronic
1129205365 15:74034349-74034371 ACGGATGCCCTGCAGGGGGACGG - Intronic
1129758704 15:78114230-78114252 AGGTATCCTCTGGGGTGGGAAGG + Intronic
1133741206 16:8652857-8652879 ATGTGTCCCCTGAATGGGGAAGG + Intergenic
1137023441 16:35452149-35452171 AGGTGTCCCCAGAGGGGGAAAGG + Intergenic
1137540038 16:49355830-49355852 ATGTATCCCATGAGGAGGGATGG - Intergenic
1152705044 17:81839072-81839094 TCTGATCCTCTGAGGGGGGAGGG - Intergenic
1152899584 17:82932644-82932666 ACGGACACCCTGAGGGGAGAAGG - Exonic
1156463205 18:37333204-37333226 ACGTATCCCCTCATGGGGTGTGG + Intronic
1157718561 18:49906225-49906247 ACCTACCCCCTGAGGTGAGAAGG + Intronic
1160057544 18:75497971-75497993 ACGTATTCAGTGAGGTGGGAGGG - Intergenic
1160465787 18:79074629-79074651 CGGTATCCCCTGATGGGAGAGGG + Intronic
1163347591 19:16753562-16753584 TAGTGTCCCCTGTGGGGGGATGG - Intronic
1163612037 19:18306650-18306672 ACGTCTCCACAGAGGGGAGAGGG + Exonic
1166823614 19:45595924-45595946 ACCAATCCCCAGAGAGGGGACGG + Intronic
1168135628 19:54349391-54349413 ACGTAGATCCTGAGGGTGGATGG + Intergenic
932036857 2:68253926-68253948 AAGTAGCTCCTGAAGGGGGAAGG - Intronic
935175629 2:100646279-100646301 AGGCATCCCCTGTGGGAGGAAGG - Intergenic
947025638 2:225734888-225734910 AGGTACTCCCTGAGGGTGGAAGG + Intergenic
948362526 2:237433023-237433045 ACTTTGCCCCTGAGGGAGGATGG - Intergenic
1168835100 20:872697-872719 AGGGAGCCCCTGAAGGGGGAGGG + Exonic
1170355939 20:15491615-15491637 CATTATCCCCTGAGGGGTGAGGG + Intronic
1179552943 21:42154835-42154857 ACCTGTCCCCTGTGCGGGGAAGG - Intergenic
1180491619 22:15854080-15854102 CCCCAACCCCTGAGGGGGGAGGG + Intergenic
1184662272 22:45970875-45970897 AGGCATCGCCTGAGGGGGGCGGG - Intronic
959328082 3:104963628-104963650 ACATGCCCCGTGAGGGGGGATGG + Intergenic
961237130 3:125376310-125376332 ACGTAACCTTTGAGGGGAGAGGG + Intergenic
967552227 3:190809965-190809987 AGTTATCCCCTGAGTGGGGAAGG + Intergenic
973271141 4:48264373-48264395 ACGGACCCCCTGAAGGGTGAAGG - Intronic
974064060 4:57061201-57061223 AAGTATCCCCTGAAGGGATAAGG - Intronic
977037019 4:91966710-91966732 AAGCAGCCTCTGAGGGGGGAAGG + Intergenic
982152582 4:152477384-152477406 ACGTATTCAATGAGGGTGGAAGG - Intronic
984860659 4:184235321-184235343 ACGTATCCCCTGAGGATGAAGGG - Intergenic
993835322 5:92812750-92812772 AAGTTTCCCCTAAGGGGGTATGG - Intergenic
997813335 5:136993411-136993433 GCGTATGCCCTGAGGGAAGAGGG - Intronic
999428214 5:151505385-151505407 ACCTAGTCCCTGAGGGTGGAGGG - Exonic
1001688529 5:173614789-173614811 ACGTATCCCCTGAGGGGGGAGGG - Intronic
1002049128 5:176559797-176559819 AGGTGTCTCCTGATGGGGGAGGG - Intronic
1008904067 6:56657043-56657065 ACGAATCACCTGAGGGAGGGGGG - Intronic
1022410776 7:30136647-30136669 ACGCACCCCCTGAGGAGGGCAGG + Intronic
1034062404 7:148105183-148105205 ACGTATCCCCGGACTGGGCATGG - Intronic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1058820763 9:108727625-108727647 ACATGGCCCCTGATGGGGGATGG - Intergenic
1060671324 9:125472187-125472209 ACATATCCCAGGAGAGGGGAAGG + Intronic
1061395212 9:130340024-130340046 TCCTATCCCCTGAGGGAGGGGGG + Intronic
1061912425 9:133732252-133732274 GCGCATCCCCTGCGGGGGGCTGG - Intronic
1062003164 9:134226845-134226867 TCGTAGCCCCTCACGGGGGAGGG + Intergenic
1190655412 X:52607844-52607866 AGGTATCCCCTGGGCTGGGACGG + Intergenic
1191908477 X:66121860-66121882 AGGGACCCCCTGAGGGGGCAAGG - Intergenic
1200319724 X:155174828-155174850 ATGTAACACCTCAGGGGGGATGG - Intergenic
1200403973 Y:2790037-2790059 ACGTATCCCACGAGGCCGGACGG - Intergenic