ID: 1001688911

View in Genome Browser
Species Human (GRCh38)
Location 5:173617542-173617564
Sequence TATAAAGCCTTACCTATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001688911_1001688914 13 Left 1001688911 5:173617542-173617564 CCCACAATAGGTAAGGCTTTATA No data
Right 1001688914 5:173617578-173617600 AAGTAGCCACAATTCACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001688911 Original CRISPR TATAAAGCCTTACCTATTGT GGG (reversed) Intergenic
No off target data available for this crispr