ID: 1001688914

View in Genome Browser
Species Human (GRCh38)
Location 5:173617578-173617600
Sequence AAGTAGCCACAATTCACCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001688912_1001688914 12 Left 1001688912 5:173617543-173617565 CCACAATAGGTAAGGCTTTATAT No data
Right 1001688914 5:173617578-173617600 AAGTAGCCACAATTCACCATTGG No data
1001688911_1001688914 13 Left 1001688911 5:173617542-173617564 CCCACAATAGGTAAGGCTTTATA No data
Right 1001688914 5:173617578-173617600 AAGTAGCCACAATTCACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001688914 Original CRISPR AAGTAGCCACAATTCACCAT TGG Intergenic
No off target data available for this crispr