ID: 1001690489

View in Genome Browser
Species Human (GRCh38)
Location 5:173629276-173629298
Sequence CAAATGTCACCTCCCAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001690489_1001690493 9 Left 1001690489 5:173629276-173629298 CCTCTCTTGGGAGGTGACATTTG No data
Right 1001690493 5:173629308-173629330 CTAAATAACAAGAAGGAGCTGGG No data
1001690489_1001690492 8 Left 1001690489 5:173629276-173629298 CCTCTCTTGGGAGGTGACATTTG No data
Right 1001690492 5:173629307-173629329 CCTAAATAACAAGAAGGAGCTGG No data
1001690489_1001690494 28 Left 1001690489 5:173629276-173629298 CCTCTCTTGGGAGGTGACATTTG No data
Right 1001690494 5:173629327-173629349 TGGGTACACTTAGACCTACAAGG No data
1001690489_1001690490 2 Left 1001690489 5:173629276-173629298 CCTCTCTTGGGAGGTGACATTTG No data
Right 1001690490 5:173629301-173629323 CTAAGACCTAAATAACAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001690489 Original CRISPR CAAATGTCACCTCCCAAGAG AGG (reversed) Intergenic
No off target data available for this crispr