ID: 1001690493

View in Genome Browser
Species Human (GRCh38)
Location 5:173629308-173629330
Sequence CTAAATAACAAGAAGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001690489_1001690493 9 Left 1001690489 5:173629276-173629298 CCTCTCTTGGGAGGTGACATTTG No data
Right 1001690493 5:173629308-173629330 CTAAATAACAAGAAGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001690493 Original CRISPR CTAAATAACAAGAAGGAGCT GGG Intergenic
No off target data available for this crispr