ID: 1001692164

View in Genome Browser
Species Human (GRCh38)
Location 5:173641333-173641355
Sequence AACTCACCAGGGTCCTGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001692164_1001692172 17 Left 1001692164 5:173641333-173641355 CCTTCTCAGGACCCTGGTGAGTT No data
Right 1001692172 5:173641373-173641395 GATGATCAGCCGCTCTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001692164 Original CRISPR AACTCACCAGGGTCCTGAGA AGG (reversed) Intergenic
No off target data available for this crispr