ID: 1001692951

View in Genome Browser
Species Human (GRCh38)
Location 5:173646388-173646410
Sequence GACACAGCTGTTCCTCCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001692941_1001692951 26 Left 1001692941 5:173646339-173646361 CCCAGGCAGAACAAGTTCCCAAA No data
Right 1001692951 5:173646388-173646410 GACACAGCTGTTCCTCCACTGGG No data
1001692945_1001692951 3 Left 1001692945 5:173646362-173646384 CCACACCTCAGAGCCAGTCCTGT No data
Right 1001692951 5:173646388-173646410 GACACAGCTGTTCCTCCACTGGG No data
1001692947_1001692951 -2 Left 1001692947 5:173646367-173646389 CCTCAGAGCCAGTCCTGTGAGGA No data
Right 1001692951 5:173646388-173646410 GACACAGCTGTTCCTCCACTGGG No data
1001692944_1001692951 8 Left 1001692944 5:173646357-173646379 CCAAACCACACCTCAGAGCCAGT No data
Right 1001692951 5:173646388-173646410 GACACAGCTGTTCCTCCACTGGG No data
1001692942_1001692951 25 Left 1001692942 5:173646340-173646362 CCAGGCAGAACAAGTTCCCAAAC No data
Right 1001692951 5:173646388-173646410 GACACAGCTGTTCCTCCACTGGG No data
1001692948_1001692951 -10 Left 1001692948 5:173646375-173646397 CCAGTCCTGTGAGGACACAGCTG No data
Right 1001692951 5:173646388-173646410 GACACAGCTGTTCCTCCACTGGG No data
1001692943_1001692951 9 Left 1001692943 5:173646356-173646378 CCCAAACCACACCTCAGAGCCAG No data
Right 1001692951 5:173646388-173646410 GACACAGCTGTTCCTCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001692951 Original CRISPR GACACAGCTGTTCCTCCACT GGG Intergenic
No off target data available for this crispr