ID: 1001693339

View in Genome Browser
Species Human (GRCh38)
Location 5:173649274-173649296
Sequence GTGCAAAATAGGACCACATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001693337_1001693339 5 Left 1001693337 5:173649246-173649268 CCATATGATAAAACTGCATGCTT No data
Right 1001693339 5:173649274-173649296 GTGCAAAATAGGACCACATATGG No data
1001693336_1001693339 16 Left 1001693336 5:173649235-173649257 CCTGGTAAATTCCATATGATAAA No data
Right 1001693339 5:173649274-173649296 GTGCAAAATAGGACCACATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001693339 Original CRISPR GTGCAAAATAGGACCACATA TGG Intergenic
No off target data available for this crispr