ID: 1001693686

View in Genome Browser
Species Human (GRCh38)
Location 5:173653600-173653622
Sequence TCTCCCCTTCTCCCAAGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001693683_1001693686 -8 Left 1001693683 5:173653585-173653607 CCCTTGATTTGGTGCTCTCCCCT No data
Right 1001693686 5:173653600-173653622 TCTCCCCTTCTCCCAAGGATAGG No data
1001693684_1001693686 -9 Left 1001693684 5:173653586-173653608 CCTTGATTTGGTGCTCTCCCCTT No data
Right 1001693686 5:173653600-173653622 TCTCCCCTTCTCCCAAGGATAGG No data
1001693681_1001693686 4 Left 1001693681 5:173653573-173653595 CCATGGGGTGCTCCCTTGATTTG No data
Right 1001693686 5:173653600-173653622 TCTCCCCTTCTCCCAAGGATAGG No data
1001693680_1001693686 5 Left 1001693680 5:173653572-173653594 CCCATGGGGTGCTCCCTTGATTT No data
Right 1001693686 5:173653600-173653622 TCTCCCCTTCTCCCAAGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001693686 Original CRISPR TCTCCCCTTCTCCCAAGGAT AGG Intergenic
No off target data available for this crispr