ID: 1001698941

View in Genome Browser
Species Human (GRCh38)
Location 5:173692646-173692668
Sequence TCATTTCCAGAGAGGGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001698941_1001698950 25 Left 1001698941 5:173692646-173692668 CCTTGAGCCCTCTCTGGAAATGA No data
Right 1001698950 5:173692694-173692716 CTTACTCAGTGAGGGGGCAAGGG No data
1001698941_1001698949 24 Left 1001698941 5:173692646-173692668 CCTTGAGCCCTCTCTGGAAATGA No data
Right 1001698949 5:173692693-173692715 TCTTACTCAGTGAGGGGGCAAGG No data
1001698941_1001698945 16 Left 1001698941 5:173692646-173692668 CCTTGAGCCCTCTCTGGAAATGA No data
Right 1001698945 5:173692685-173692707 TACTGCAGTCTTACTCAGTGAGG No data
1001698941_1001698948 19 Left 1001698941 5:173692646-173692668 CCTTGAGCCCTCTCTGGAAATGA No data
Right 1001698948 5:173692688-173692710 TGCAGTCTTACTCAGTGAGGGGG No data
1001698941_1001698946 17 Left 1001698941 5:173692646-173692668 CCTTGAGCCCTCTCTGGAAATGA No data
Right 1001698946 5:173692686-173692708 ACTGCAGTCTTACTCAGTGAGGG No data
1001698941_1001698947 18 Left 1001698941 5:173692646-173692668 CCTTGAGCCCTCTCTGGAAATGA No data
Right 1001698947 5:173692687-173692709 CTGCAGTCTTACTCAGTGAGGGG No data
1001698941_1001698944 -7 Left 1001698941 5:173692646-173692668 CCTTGAGCCCTCTCTGGAAATGA No data
Right 1001698944 5:173692662-173692684 GAAATGAGATGCAGACAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001698941 Original CRISPR TCATTTCCAGAGAGGGCTCA AGG (reversed) Intergenic
No off target data available for this crispr